Gene HMG20B Variant 1
DNA : 4.56 KbNT_011255
mRNA : 1228 bp NM_006339
CDS : 1024 bp NP_006330
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  63 bp
gccaggcccccctcccaacgacgcagcccggttctgcagccggtgaagaaacgcggctgg
cccaagggcaagaagcggaagaagattctgccgaatgggcccaaggcaccggtcacgggc
tacgtgcgcttcctgaacgagcggcgcgagcagatccgcacgcgccacccggatctgccc
TTTCCCGAGATCACCAAGATGCTGGGCGCCGAGTGGAGCAAGCTGCAGCCAACGGAAAAG
CAG
gtgggcggggcggggcgccgagcagggctggcggggtccacggactaccccccagtagcc
ccgacccccaaaggattccacgtgcagggtttttccttcttcctggagaaatgcccaccc
ataaccaactttttttttttttttttttgtgagatggagtcttgctctgttgcccaggct
EXON 2  121 bp
aggtgggagctcggaggtccctgagcaacaggctgaggagccggttctgtctgcctggag
ggaatagggagctatagaaggttcaggagaggggagggtgctgtgaaagcagagtgataa
agactggatcctggcgttggaggcttcccctgcttcaagccttctggtgctgccccccag
CGGTACCTGGATGAGGCCGAGAGAGAGAAGCAGCAGTACATGAAGGAGCTGCGGGCGTAC
CAGCAGTCTGAAGCCTATAAGATGTGCACGGAGAAGATCCAGGAGAAGAAGATCAAGAAA
G
gtgggaggggtcgggcgcggtggctcacgcctgtcatcccagcactttgggaggccgagg
cgggtgtatcacctgaggtcagaccagcctggccaacatagtgaaaccctccccctctac
taaaaatacaaaaattacctgggcgtggtggcgggtgcctgtaatcccagctactcggga
EXON 3  47 bp
gggaaagatacatagccagacaggagtgaagggggctcactcggtacagcgatgggggat
gcccagacgcggggcactcaagtggggagctggagccggctgagcagcgctgacctaggg
tgcagggcgtggtccctggaggcctgggaggctgaccctgcccttcccctcccccgccag
AAGACTCGAGCTCTGGGCTCATGAACACTCTCCTGAATGGACACAAG
gtaagcgaccttcttcctctcaaagcacctgggggagaaaggtctggaggcttctagaac
cctgagtcagagccagtgctcgcccagatgtgtgcaagcaggggcggtgccactgcaccg
tgggatcgctgttgattgtactcccaccggggtgtcccaggagaccctcctaggcttggg
EXON 4  73 bp
gtcagagccagtgctcgcccagatgtgtgcaagcaggggcggtgccactgcaccgtggga
tcgctgttgattgtactcccaccggggtgtcccaggagaccctcctaggcttggggcaca
cccagagagcgtggctgcctcctaccaccagtaaattgccaccttgtcccttcgtcttag
GGTGGGGACTGCGATGGCTTCTCCACCTTCGATGTTCCCATCTTCACTGAAGAGTTCTTG
GACCAAAACAAAG
gtgagcggtaactgcgctcctgatgcgaactccgtgaaactgggtggtagaggggggcgt
gggccaggagggccccaagactgcaggaggcggatcgggaggttccctatgagcgtccag
gcgcacgctgtcgctccagaggctgatgtggagcaggaggcagagggcgcagtgagggaa
EXON 5  216 bp
gaggcggatcgggaggttccctatgagcgtccaggcgcacgctgtcgctccagaggctga
tgtggagcaggaggcagagggcgcagtgagggaaacctgggcaggggcacgtcccgggca
aaagcccggaggtaggggaaaggggaggcgcaggctttgaccccgctccccccggcgcag
CGCGTGAGGCGGAGCTTCGGCGCTTGCGGAAGATGAATGTGGCCTTCGAGGAGCAGAACG
CGGTACTGCAGAGGCACACGCAGAGCATGAGCAGCGCGCGCGAGCGTCTGGAGCAGGAGC
TGGCGCTGGAGGAGCGGAGGACGCTGGCGCTGCAGCAGCAGCTCCAGGCCGTGCGCCAGG
CGCTCACCGCCAGCTTCGCCTCACTGCCGGTGCCGG
gtgcgggccacgcccatctcccagtcccgccccggtcacccggccccgcccgcctccccc
cccctcctcccttccccccttcccctgtcgcccggcgccgcccatcgccccgtcccctct
tccccagtcacccggccccgcctatcgccccgccctcatcacccccagctccgcctcctc
EXON 6  133 bp
tcctcgccatcctcctgccccggcttaccttagcccaccctgcgccgctcctgcgctggc
ggtgtccggacctctgagcgcccgcgcgacccgccctgagtcaccccctaccgctgcccc
tggagcccccgccccgcgactccccggcaccctcgcctgaccttcccgcctgtcccccag
GCACGGGCGAAACGCCCACGCTGGGCACTCTGGACTTCTACATGGCCCGGCTTCACGGAG
CCATCGAGCGCGACCCCGCCCAGCACGAGAAGCTCATCGTCCGCATCAAGGAAATCCTGG
CCCAGGTCGCCAG
gtgtgtgccgggcgaggcggggcggggccggggttcaaggcccggatgtgcccgccctgg
ggttccccaggtccgcgagggctgctgggtgggactccgcagcttactagagatcacctc
ccggaggggcctacctgcggtcgcccctgatgcaccagtgctaggatggccatggagaac
EXON 7  575 bp
cttccctaaagcttctcagggtggatcccagcgcccgggttagataggttcaacgcctgt
cccccaaccctggcatctgttggagcagctgatgggccatggtctctggggttccccagg
gccggggtgggggccagagatgatgagggcctcatcccgggccctcctctctcgtttcag
CGAGCACCTGTGAGGAGTGGGCGGGCCCACGATGCAGAGGAGAAGCTGTGGGCGCGGCCC
TGCCACACCCCACCCCGTGGACGAGAGGCTGGGGGTCCACCCTTTGGGGCCTGGTCCCAT
CCTGCACCTTGGGGGCTCCAGCCCCCCTAAAATTAAATTTCTGCAGCATCCCTTTAGCTT
TCAATCTCCCCAGCCCCCTGAACCCGGAAAAAGCACTCGCTGCGCGATACACCCAGAAGA
ACCTCACAGCCGAGGGTGCCCCTCCTCGGAGGACAGCCACGCGCTACACTGGCTCTCCGG
GCCACCCCCAGGACACAGGGCAGACGAAACCCACCCCCAGCACACGGCAGGACCCCCCAA
ATTACTCACTACGGGGGGCTGTGCCATAGGCCACACAGGAAGCTGCCTTGTGGGGACTTA
CCTGGGGTGTCCCCCGCATGCCTGTACCCCAGATGGGTGGGGGCCGGCTTTGCCCATCCT
GCTCTCCTCCAGCCGAGGGACCCTGGTGGGGGTGGCTCCTTCTCACTGCTGGATCCGGAC
TTTTTAAATAAAAACAAGTAAAATTTGTGTTTTAA
gcttgtgagtgtgtaagcttgtttggggtggtgtggagggttcagaaggtgcagcctggg
ccccccatgacattccctgctgggggcgccaggcctgctctctttacctctagcagagcc
tcagagtttctcagatagggagacgggagcccaaacttgccggggttcacagagcaagtc