Gene GIPC3 Variant 1
DNA : 4.86 KbNT_011255
mRNA : 1212 bp NM_133261
CDS : 939 bp NP_573568
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  252 bp
ctggccctggcagggcccggacacctggggcccgacccacccctgcgcaccccgcggtgt
cgccttcccgggaggctcgggttcccagatccccttacccgggcgtctcggctgtcgcgc
cctgggccgggggaggggaggctgcaggaagcggcggatccggcggcggcggcgagggcc
CGGGTGGGTGGCCGAACTTCTCCCGCCATGGAGGGAGCAGCGGCCCGGGAGGCCCGGGGG
ACCGAGACCCCGCGCGCGTCTGCGCCCCCGCCCGCGCCCTCGGAGCCCCCGGCCGCGCCC
CGCGCCCGCCCGCGCCTCGTCTTCCGCACGCAGCTGGCGCACGGGAGCCCCACGGGCAAG
ATCGAGGGCTTCACCAACGTCCGCGAGCTGTACGCCAAGATCGCCGAAGCCTTCGGGATC
GCGCCCACCGAG
gtaaggagcccggacaccggcgcccaagaccacccgcctgatggggtgaggggtagggag
cttggaccctggacgggagaccccagatccccggatcccagacgtcggggtggccgccta
atcgccggatctcagagacccagccctcagatcccggggtgccacactcccaggggcccc
EXON 2  186 bp
ggggtctccacctgctggaagtctccttctccctcctctctctgttctgggggtcccacg
ccctgccctttcccatgggctgggatcctggtcgctgggggcaggggcctgcgcagacag
ggtggctgcgtggggggatgcatgccctggctaactctaggctccttctcccccgggaag
ATTTTATTCTGCACCCTCAACAGCCACAAAGTGGACATGCAGAAGCTCCTGGGGGGTCAG
ATAGGCCTGGAGGACTTCATCTTTGCCCACGTGCGAGGCGAGACCAAGGAGGTGGAGGTC
ACTAAGACAGAGGATGCTCTGGGGCTGACCATCACGGACAACGGGGCTGGCTACGCCTTC
ATCAAG
gtgcccgggagggggtgggcgggtggcttcctggggtccagcaactgccccccccactct
gggtcgacgtgggttctgcggattggaggcgggtggctggggttgccctgccagcgacgc
tggatccctgcagagaatcaaggaaggcagtatcatcaaccggatcgaggcagtgtgcgt
EXON 3  181 bp
tggggctgaccatcacggacaacggggctggctacgccttcatcaaggtgcccgggaggg
ggtgggcgggtggcttcctggggtccagcaactgccccccccactctgggtcgacgtggg
ttctgcggattggaggcgggtggctggggttgccctgccagcgacgctggatccctgcag
AGAATCAAGGAAGGCAGTATCATCAACCGGATCGAGGCAGTGTGCGTGGGTGACAGCATC
GAAGCCATCAACGACCACTCCATTGTGGGCTGCCGCCACTACGAGGTGGCCAAGATGCTC
CGGGAGCTGCCCAAGTCCCAGCCCTTCACCCTGCGCCTGGTGCAGCCCAAGAGGGCCTTC
G
gtgaggcgggtgggctggcgggagctcttcccgaagtgcgttctacggatgcctggggtg
gaggagggtcggggatgggacgggctggaaggttctaggtgcacccgctgcgtgccaagg
agctcctggcagggtatcagaaactcgtaggtagtttctattaatagattgttatggagt
EXON 4  113 bp
tttgctggggatgcgaagtgtggaatctcgaataggtctctggagacttgccgtacagat
gtaaggaggactttgaaggggaggaagattctagaaaggctcggctgttggcctcccagg
gtttacaaagatgtggctccacccagaacccatggccatccctcactctgttccctccag
ATATGATTGGCCAGAGAAGTCGGTCCAGCAAATGTCCAGTAGAGGCGAAAGTGACCAGCG
GGAGGGAGACCCTGCGGCTTCGTTCTGGGGGGGCTGCCACAGTGGAGGAAGCG
gtgagtgaaggggaggggctctccccaggcttctgcaccttcagctcctccactgagtca
gtgcggtcttgggtaagaacttctcctcggagcctcagtttctctgcctgcaaaatgggt
cctcattgaaaagtggggcaatgatgttggtaccagcactactgactcgtgtgagggtcc
EXON 5  82 bp
cagtttctctgcctgcaaaatgggtcctcattgaaaagtggggcaatgatgttggtacca
gcactactgactcgtgtgagggtccagtctactcttcccttaggggtgggggtcgggagg
gggctgggctggagggctccaaagcttttcacccctgacttccctcccgtgtgcccccag
CCCAGTGAGTTTGAGGAGGAGGCATCTCGGAAGGTTGATGACCTGCTGGAAAGCTACATG
GGCATTCGGGACCCCGAGCTGG
gtaaggggccagggtaagccagggggccctggggggagggaagcctacgggaggaggcag
gggtcccagcgggaagttgggcgcggggagtgccctcactgacatcccctctggcacggc
ccgcagcgtccaccatggtggagacgtccaagaagacagcgagcgcccaggagtttgcac
EXON 6  398 bp
ggaaggttgatgacctgctggaaagctacatgggcattcgggaccccgagctgggtaagg
ggccagggtaagccagggggccctggggggagggaagcctacgggaggaggcaggggtcc
cagcgggaagttgggcgcggggagtgccctcactgacatcccctctggcacggcccgcag
CGTCCACCATGGTGGAGACGTCCAAGAAGACAGCGAGCGCCCAGGAGTTTGCACGCTGTT
TAGACTCCGTCTTGGGCGAGTTCGCCTTCCCCGACGAGTTTGTGGTGGAAGTGTGGGCCG
CCATCGGCGAGGCCAGAGAGGCCTGTGGCTAGTTTGCCCTGGGGGGGCCCAGCACAGCCC
CAGCCCGGAGCCCAGCCCCCTGCCCCGGCCCTGCTCCAGAACCCAGCCCAGATCGGAGGA
CAAGTTCCTCTCTAGAACCCAATCCAATTTGGAGCCCCAGCCCAACTCCAGAACCCAACC
CTTCTCTAGAATCCAGCCCAGATCTGAGGCCAAGCTATGTGCTAGAGCCCAGGCCAGCTC
TGAGACCAAGCCCAGCATTGAGAATAAGCTCTGTTCTA
aaactcaggccagccctgagaccaagcccagctctagaactcagatgagctttgagacca
tgcccagcactgagaccaagccctgttctagaactcaggcctgctctgaggccaagccca
gctctagaacccagatgagctctgagaccatgcccagctctagaactcagatgggctctg