Gene FKBP8 Variant 1
DNA : 10.10 KbNT_011295
mRNA : 1546 bp NM_012181
CDS : 1071 bp NP_036313
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  191 bp
gactttgaggggctgtgtaggattctgacccacatctctgccccccacttccagggccaa
ttcctgtccccccagcagcatggcatcgtgtgctgaaccctctgagccctctgccccact
gcccgccggggtcccaccgctcgaggacttcgaggtactggatggggttgaggatgcaga
GGGTGAGGAGGAAGAGGAGGAGGAAGAGGAGGAAGAGGATGACCTGAGTGAGCTGCCACC
GCTGGAGGACATGGGACAACCCCCGGCGGAGGAGGCTGAGCAGCCTGGGGCCCTGGCCCG
AGAGTTCCTTGCTGCCATGGAGCCCGAGCCCGCCCCAGCCCCGGCCCCAGAAGAGTGGCT
GGACATTCTGG
gtaaggagcaaaggtggatcagggtgcccttggccctggccctctcgtcccctgagcctc
atttccccatctgtgctgtgagggttggaagtcacgtggtcaccaccgtgatcaccagcc
agaggcaactactggagatgcttcacattgatgtactctatccactgactcacacacatg
EXON 2  170 bp
cgtggggttccccactctggtggcagagtggccattggaagtttggtttgtgccccagtg
ttgggccagccccctctggacagctagtgggcagagctgagggtaggagtgggggctcag
gggagcgggtgcctgtttgagctgccaggtgacaggctgcatgtccctggaccctggcag
GGAACGGGCTGTTGAGGAAGAAGACGCTGGTCCCAGGGCCGCCAGGTTCGAGCCGCCCGG
TCAAGGGCCAGGTGGTCACCGTACATCTGCAGACGTCGCTGGAGAATGGCACACGGGTGC
AGGAGGAGCCGGAGCTGGTGTTCACTCTGGGTGACTGTGACGTCATCCAG
gtgcgggctggggcgggacagggcaggggcgaggggcgtgccttgctgggtctgagtctg
cctgacagctggctatccccacacaccccaggccctggatctcagtgtcccactcatgga
cgtgggggagacggccatggtcactgctgactccaagtactgctacggcccccaaggcag
EXON 3  89 bp
tacatctgcagacgtcgctggagaatggcacacgggtgcaggaggagccggagctggtgt
tcactctgggtgactgtgacgtcatccaggtgcgggctggggcgggacagggcaggggcg
aggggcgtgccttgctgggtctgagtctgcctgacagctggctatccccacacaccccag
GCCCTGGATCTCAGTGTCCCACTCATGGACGTGGGGGAGACGGCCATGGTCACTGCTGAC
TCCAAGTACTGCTACGGCCCCCAAGGCAG
gtgagagtcagccacccttaggtctctgcaggtctcaggagggggatgggtggagtgggt
gtacccctcggctcaccccatctacttgcccattttatagacaagaaactgaggctgggt
gaggtggctcacacctgaaatcccagcactttgggaggttgaggtaggaggattgcttga
EXON 4  221 bp
aagtcccgcagctccaaggcggcaagtcacttcccctgcactttactgaggagggaatga
tggagggcagaggggagacagatcgggggcttgagccaagctcactccttcctagccagc
ccagcgggtttaggggtcaccaggtctgagtgctgcccctgcctgctcccacccaactag
CAGGAGCCCATACATCCCCCCGCACGCGGCCCTGTGCCTGGAGGTGACCCTGAAGACGGC
TGTGGACGGGCCTGACCTGGAGATGCTCACGGGGCAGGAGCGCGTGGCCCTGGCCAACCG
GAAGCGGGAGTGCGGCAACGCCCACTACCAGCGGGCGGACTTCGTCCTGGCCGCCAACTC
CTACGACCTCGCCATCAAGGCTATCACCTCCAGCGCCAAAG
gtgaccgcctgggtcagatctccaccatctcccctgcaaaggtgtccactccgtgccaga
aacttccagccccagagagcctcagactcagaatattctagaatagcccagaatatgggt
agatccccaactgcccctaagctagggcctgttacagactcgtggtatatcccagaccag
EXON 5  173 bp
tcgcttgcttaagtctccatcttgtagcttcctcaggagagccccaggaaagcgtggccc
ttggtccggggttaaaattggggaaactgaggccagagaggcagcctccgcagaggggtg
ggtgccggggtgtctggtggcatggtgacggctgccgtggcgggcactgtctcccaatag
TGGACATGACGTTCGAGGAGGAGGCACAGCTCCTGCAGTTGAAGGTGAAGTGTCTGAACA
ACCTGGCGGCCTCGCAGCTGAAGCTCGACCACTACCGCGCAGCCCTGCGCTCCTGCAGCC
TTGTGCTGGAGCACCAGCCAGACAACATCAAGGCTCTCTTCCGCAAGGGCAAG
gtaggccacaccggggtgccaggccgggtcactcagcctggggtatacggggtggtcccc
aaccctgcatttgagaaaggcataggtatataagccagctgagctctgtggggtgcaggt
ggagaaactgaggcccagacgggtgcaggagtgtggcctggtcacaacaattcattggct
EXON 6  78 bp
ttctccatgttggccaggctgtttttattttattttattttttgagatggagtcttgctc
tgttgctcaagctggagtgcagtgacaccatcttggctcactgcaacctcctgggctgga
tttcttgaaggacaggcccaggtatgggtccagagtgatgccacccccttccccttacag
GTGCTGGCCCAGCAGGGGGAGTACAGTGAGGCCATCCCCATCCTGAGGGCAGCCCTGAAG
CTGGAACCTTCCAACAAG
gtgagcaggacaggggtgccctgggacttgctcggctgggaagtccctcctgcggtctgc
cccaggtctttcttgctgtggctctctgttgtgttcccacctgggcagtggcacggagta
ggtacctgaagggtcctggtcagcttgtgaagaccctcatgacggccacacaggcagtct
EXON 7  132 bp
ttggctccctaggagggatggggtcagcagccctgactttgctaagcccagaaaggggca
gatgggacccctgtgtcccaacagtcccaccacccaaacagcctagggtcccagtaaggc
agagcgccagtgatgacaggttggccgctgcgtgttctcagcttcccctgccttctgcag
ACGATCCACGCAGAGCTCTCAAAGCTGGTGAAGAAGCATGCGGCGCAGCGGAGCACGGAG
ACCGCCTTGTACCGGAAAATGCTGGGCAACCCCAGCCGGCTGCCTGCTAAGTGCCCTGGC
AAGGGTGCCTGG
gtgagctggggcacagaatgggcaggggctgtgtgcagggcacgcctagcagagggattt
tattttgcatacatggatgtcctcggagactgggccgtcctgggcgatgcaggggacgtg
gagagagcccagccctgtgtgatcatgagtggagtcgaaggtggaactcaagctggaggg
EXON 8  492 bp
tggaggaggggccatttgatttgggttttgctgcatgagtaggagtttgccaggaagtgg
gaaatacatagtcaggcaatgatttgttgggaggtctgtttgggctgtgctggcagctga
ggccccagaggccagtcttgacctccctccacccttctctcccctcctttttatccacag
TCCATCCCATGGAAGTGGCTGTTTGGGGCGACTGCTGTTGCCTTGGGGGGTGTGGCACTC
TCTGTGGTCATCGCTGCCAGGAACTGACCACCTAGGTGGCTGCCACCCCCTCTGCACACC
ATGGACCCTGCCCTGCGCTCCCCAACTCCCCCAGGCTCCCTGTCCACTGCCCTCCCTGGT
CTGGCCCCCTCCTCCGGGTTAGGGGAGCAAGGATTGGGGGTCGTGCAGCCCAGCCAGCAG
GAGGGACTGAGGCCCTCTAGGAGGAAAGCCCAGAGGGAGGGGGCCCTCATTCCTTCAGAC
CCAGTTTTCCCCCACCCTCCTTACCCCGCTGGGCTAGGTCTCCGCCAGGGCTGGCCTCAG
TTTCTCCTCAACAGGCCTGGGGGCAGCCCTTCCCCTGCCTAGTCCCCGCCTGAGTGCCAG
CCCCCCACCCCGCCTGCCGCCCCCTGTCCAGGTTCCCTCCCCGCCACAGTGAAATAAAGC
ATCCCACCCTGC
agtttccacggactcctgagctttcttctcccgctgtctggggctgggccagagacagcc
tgtgatgcatctggagtcacacagcatggtggatgtggttgagccagctggagctggggg
tctcctctccgggcacaacatactcactttacagaggagaaactgaggcatagagaagtg