Gene FGF21 Variant 1
DNA : 1.98 KbNT_011109
mRNA : 630 bp NM_019113
CDS : 630 bp NP_061986
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  235 bp
tctgcatctatcccaaaaaacaagggtgttctgtcagctgaggatccagccgaaagagga
gccaggcactcaggccacctgagtctactcacctggacaactggaatctggcaccaattc
taaaccactcagcttctccgagctcacaccccggagatcacctgaggacccgagccattg
ATGGACTCGGACGAGACCGGGTTCGAGCACTCAGGACTGTGGGTTTCTGTGCTGGCTGGT
CTTCTGCTGGGAGCCTGCCAGGCACACCCCATCCCTGACTCCAGTCCTCTCCTGCAATTC
GGGGGCCAAGTCCGGCAGCGGTACCTCTACACAGATGATGCCCAGCAGACAGAAGCCCAC
CTGGAGATCAGGGAGGATGGGACGGTGGGGGGCGCTGCTGACCAGAGCCCCGAAA
gtgagtgtgggccagagcctgggtctgagggaggaggggctgtgggtctggattcctggg
tctgagggaggaggggctgggggccttggcccctgggtctgagggaggaggggctgggga
tctggactcctgggtctgagggaggaggggctggggatctgggcccctgggtctgaggga
EXON 2  104 bp
cttgggtctgagttgggagggggctttggcttgggcttctcctgggtctgagggaggagg
taggctgtgggcttggactcccagggctgggacagagccggatggtgggacagagtcggg
tggtgggacagtcccgggtgggagaggtcctcgaaccaccttatcgctttcaccccttag
GTCTCCTGCAGCTGAAAGCCTTGAAGCCGGGAGTTATTCAAATCTTGGGAGTCAAGACAT
CCAGGTTCCTGTGCCAGCGGCCAGATGGGGCCCTGTATGGATCG
gtgagtttccaggaccctcctcaccacccaccatgctcctcctatatgtcgccctcacag
cctggggtgccttgtcttgctcatcccccccggagccagacttgattctatttgctctgc
acgcccccagctgcaacatttggaggttgaagttgtcatcagtgtttgcaagatgaggaa
EXON 3  291 bp
gggcctggactcctgggtcggatggaggagaaactagggtctggacccctgggtctgagg
gaggaggcgctgggggcctggacccctgggtctgagggaggcagggctggggcctggatc
ctgggtcttacatcaggaaaacagaggaaccctgtctctgatcctgtttttgtcccctag
CTCCACTTTGACCCTGAGGCCTGCAGCTTCCGGGAGCTGCTTCTTGAGGACGGATACAAT
GTTTACCAGTCCGAAGCCCACGGCCTCCCGCTGCACCTGCCAGGGAACAAGTCCCCACAC
CGGGACCCTGCACCCCGAGGACCAGCTCGCTTCCTGCCACTACCAGGCCTGCCCCCCGCA
CTCCCGGAGCCACCCGGAATCCTGGCCCCCCAGCCCCCCGATGTGGGCTCCTCGGACCCT
CTGAGCATGGTGGGACCTTCCCAGGGCCGAAGCCCCAGCTACGCTTCCTGA
agccagaggctgtttactatgacatctcctctttatttattaggttatttatcttattta
tttttttatttttcttacttgagataataaagagttccagaggaggataagaatgagcat
gtgtgagtgtctgagggaagacatggcagctgttttgtctcccttggcccggacaatccc