Gene EFNA2 Variant 1
DNA : 13.78 KbNT_011255
mRNA : 642 bp NM_001405
CDS : 642 bp NP_001396
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  140 bp
tctcggcgcccgaggtcgcgcgcgcggaggcgggggcggcccgggatctccaagcgccgc
cgcgccctcctcccgcccgccctccgcccgcccgctcggcggcggcggcggcggcggagg
aggcggagaaggctggcaggcggcggccgggagagcgagcgcggcggccggaccggggcc
ATGGCGCCCGCGCAGCGCCCGCTGCTCCCGCTGCTGCTCCTGCTGTTACCGCTGCCGCCG
CCGCCCTTCGCGCGCGCCGAGGACGCCGCCCGCGCCAACTCGGACCGCTACGCCGTCTAC
TGGAACCGCAGCAACCCCAG
gtgagcgcggccgcgcgcggggggcgcccggggaccccccaacgccccccaagccgcgcc
cggcctcgcgcccccggagctccgggcgccccccacgcgcgcgccgccgccgggatgcgg
gcgcccggttcccgcgggagccccccagggagctccggccccccggagtttgggggactc
EXON 2  314 bp
tgaccctgtcccccctggcgcaccctgacccgtcccccgtgctcctgaccccggccctcg
ccgcgcaccccgacccgtccctcgtgctcctgtcccctgaccctggccctccccgcgcac
cccgacccgtgccccgttcctcgctccgggcgctgacctctggccgccttgtccccgcag
GTTCCACGCAGGCGCGGGGGACGACGGCGGGGGCTACACGGTGGAGGTGAGCATCAATGA
CTACCTGGACATCTACTGCCCGCACTATGGGGCGCCGCTGCCGCCGGCCGAGCGCATGGA
GCACTACGTGCTGTACATGGTCAACGGCGAGGGCCACGCCTCCTGCGACCACCGCCAGCG
CGGCTTCAAGCGCTGGGAGTGCAACCGGCCCGCGGCGCCCGGGGGGCCGCTCAAGTTCTC
GGAGAAGTTCCAGCTCTTCACGCCCTTCTCCCTGGGCTTCGAGTTCCGGCCCGGCCACGA
GTATTACTACATCT
gtgagtggggtcgggccggggctgccggggcccgagtgggcggggacgcgggggcggggc
caggaagtgggcgggaccactggggtggggccggggagtgggcggggcagcgcagtgggc
ggggccgcggtgtggggccaggggggagtgggcggggccgcggaatggggccagggggga
EXON 3  66 bp
agactgctgggaaacagggggcattgtgtctggggctttgatgtacgattaggagtttta
agggtggctctccacctggggtcagggttgattcaccaaggtggggaagggagtacagcc
ccaggaggtctcaggcaccaagaggcacttccccactcatccccatcccctctcttctag
CTGCCACGCCTCCCAATGCTGTGGACCGGCCCTGCCTGCGACTGAAGGTGTACGTGCGGC
CGACCA
gtaagtgctcagggggatgggcaggatccaggcccccacccctgtgtcctaaacccacag
aaccagtgagtgttcagaagagccaggacagggggcctcgggtttccctatcttgccctg
ccttgccccagcctcgatttccccgtctgatgaacatgtcagaccttcgagagtgaaggt
EXON 4  122 bp
tcaggccaagtgactttgcccggagagtgggcatcggggatggcaccaagagggagcaga
gggcctgcctggtggggtgatgagcccgttgggcagatgtgcaccctgagggcgggcggc
acgtggggagcccagtggggttcgggcggccgctgagcgtgctgtctctgccacccgcag
ACGAGACCCTGTACGAGGCTCCTGAGCCCATCTTCACCAGCAATAACTCGTGTAGCAGCC
CGGGCGGCTGCCGCCTCTTCCTCAGCACCATCCCCGTGCTCTGGACCCTCCTGGGTTCCT
AG
tcccagccccgcaggacgccgaccctgcctggacggccccgcctggaccgcctgacctcg
gccctccggacccggctgcggcccccgcctccgagaccaaatagagacgctgcttctccc
tcgcctggtgccgcccccgccgggcaggggccatccacccgccccaggaccagccctcag