Gene DNASE2 Variant 1
DNA : 6.26 KbNT_011295
mRNA : 1955 bp NM_001375
CDS : 1083 bp NP_001366
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  179 bp
accacgaaaaggaacggtggccaggctccaggagacgctggagcgccgggcccgtcgtgg
gcgtggtctgggcagactcagcgttgccttttgcctctccaaaacgcagcatcgcgtctc
gggggaggagtctgtaccctcgtgatgtccccgccccggttcccaggcaagtttagggaa
GTGAAAGGCGCCAGGTGCCAGTCCTGGCCTCTGATGTAACCCAGCGCCCCGCAGTCCCGA
CACAGATTCCTGGATCTCAGCCCCATAGCAGCTATGATCCCGCTGCTGCTGGCAGCGCTG
CTGTGCGTCCCCGCCGGGGCCCTGACCTGCTACGGGGACTCCGGGCAGCCTGTAGACTG
gtgagtgcgcagcggggggcctaccatcgccccggggtccggctgcggtcactcaaccgg
gatggctacctcctcggggaaccctggggtgccttctcttccctctctcctatttctgtg
cattctccgacctccaggttcgtggtctacaagctgccagctcttagagggtccggggag
EXON 2  181 bp
gggccctgacctgctacggggactccgggcagcctgtagactggtgagtgcgcagcgggg
ggcctaccatcgccccggggtccggctgcggtcactcaaccgggatggctacctcctcgg
ggaaccctggggtgccttctcttccctctctcctatttctgtgcattctccgacctccag
GTTCGTGGTCTACAAGCTGCCAGCTCTTAGAGGGTCCGGGGAGGCGGCGCAGAGAGGGCT
GCAGTACAAGTATCTGGACGAGAGCTCCGGAGGCTGGCGGGACGGCAGGGCACTCATCAA
CAGCCCGGAGGGGGCCGTGGGCCGAAGCCTGCAGCCGCTGTACCGGAGCAACACCAGCCA
G
gtgaagggggccccgggccaactaggggcgaaactctagggctgccctgcctgggaggaa
tttcacgttgcctccgtttatccgcccgcagctcgccttcctgctctacaatgaccaacc
gcctcaacccagcaaggctcaggactcttccatgcgtgggcacacgaagggtgaggcctg
EXON 3  79 bp
gctggcgggacggcagggcactcatcaacagcccggagggggccgtgggccgaagcctgc
agccgctgtaccggagcaacaccagccaggtgaagggggccccgggccaactaggggcga
aactctagggctgccctgcctgggaggaatttcacgttgcctccgtttatccgcccgcag
CTCGCCTTCCTGCTCTACAATGACCAACCGCCTCAACCCAGCAAGGCTCAGGACTCTTCC
ATGCGTGGGCACACGAAGG
gtgaggcctggattgggggctggggagagactcgggtcccatttttccaaggtaacccct
gacgtgcatggggtggtcggggagatctgcactgtcagaccctgggcatctattcccccc
aacttttttttttctttgtttttgagacggtgggagttcgctctgtcacccaagctggag
EXON 4  165 bp
tccaccaccacgctcagctaatttttgtatttttagtagagatggggtttcgccatgttg
gccaggctgatttctaactcctgacctcaggtgatctgtgtgtctcggtctcccaaagtg
ctgggattacaggcgtgagccactgcgcccgacctcccctaatgccttcttttggtccag
GTGTCCTGCTCCTTGACCACGATGGGGGCTTCTGGCTGGTCCACAGTGTACCTAACTTCC
CTCCACCGGCCTCCTCTGCTGCATACAGCTGGCCTCATAGCGCCTGTACCTACGGGCAGA
CCCTGCTCTGTGTGTCTTTTCCCTTCGCTCAGTTCTCGAAGATGG
gtaagtcgagtcagggacacaggatgagtcctgggtttactgaccagaacctggaacgat
cttgcatttcctcctccccttgtcctccaggcaagcagctgacctacacctacccctggg
tctataactaccagctggaagggatctttgcccaggaattccccgacttggagaatgtgg
EXON 5  198 bp
ctgctgcatacagctggcctcatagcgcctgtacctacgggcagaccctgctctgtgtgt
cttttcccttcgctcagttctcgaagatgggtaagtcgagtcagggacacaggatgagtc
ctgggtttactgaccagaacctggaacgatcttgcatttcctcctccccttgtcctccag
GCAAGCAGCTGACCTACACCTACCCCTGGGTCTATAACTACCAGCTGGAAGGGATCTTTG
CCCAGGAATTCCCCGACTTGGAGAATGTGGTCAAGGGCCACCACGTTAGCCAAGAACCCT
GGAACAGCAGCATCACACTCACATCCCAGGCCGGGGCTGTTTTCCAGAGCTTTGCCAAGT
TCAGCAAATTTGGAGATG
gtgagtctcaaggttgagggttggagagctccttctctgcagacagggtgactggtgtgg
ccatggctgagttcaagtcagcggtagagaccaggtctgtttgggagctataatcacatg
atcagtgaacagacctgggttcaaaccctgggttttgctgtgtgatgtataacttcacct
EXON 6  1153 bp
aggttgcaatgagcctagattgcaccaatgcactctagcctgggcgacagagcaagactc
catgtcaaaaaaaaaaaaaaaaaaggaaatatggaaactgagctgagagaggggaagtgg
actagggactccctcgcagtggccctgaccctacctgtgccctctctccatcctttgcag
ACCTGTACTCCGGCTGGTTGGCAGCAGCCCTTGGTACCAACCTGCAGGTCCAGTTCTGGC
ACAAAACTGTAGGCATCCTGCCCTCTAACTGCTCGGATATCTGGCAGGTTCTGAATGTGA
ACCAGATAGCTTTCCCTGGACCAGCCGGCCCAAGCTTCAACAGCACAGAGGACCACTCCA
AATGGTGCGTGTCCCCAAAAGGGCCCTGGACCTGCGTGGGTGACATGAATCGGAACCAGG
GAGAGGAGCAACGGGGTGGGGGCACACTGTGTGCCCAGCTGCCAGCCCTCTGGAAAGCCT
TCCAGCCGCTGGTGAAGAACTACCAGCCCTGTAATGGCATGGCCAGGAAGCCCAGCAGAG
CTTATAAGATCTAACCCTTATGGCCAGGTGCAGTGGCTCACGTATGTAATCCCAGCACTT
TGGGAAGCCAAGGAGGGAGGATCACTTGAACTCAGGAATTCGAGACCAGCCTGGGCTACA
TAGTGAGACCACATCTCTACTAGAACTTAAAAAAAGTTAGCCAGGCACGGTGATAAATGC
CTGTAGTCCCAGCCACTGAAGCCAGAGGATCGATTGAACCAGGGAGATCATGGTCACAGT
GAACTATGATTACGCCAACCTGGGTCACATAGCAAGACTCTGTTTCAAAAAAAAAGGGGG
GGCGGGGGACGGGTGGGTGCAGTGGCTCACATCTGTAACCCCAGCACTTTGGGAGGCTGA
GATGGGCAGATCACTTGAGGTCAGGAGTTCGAGACCAGCCTGGCCAACATGGTGAAACCC
CATATCCATTAAAAATATTTAAAAATTAGCCAGACATGGTGGCACGCGTCTGTGGTCCTA
GCTCCTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACTCGGGAGGCAGAGGTTGTCATGA
GCTGAGCTAACACCACGGCACTTCAGCCTGGGTGACAGAATGAGACTCTGTGTCAAAAAA
ATAAAAAATAAAAAATCTAAGGGCTCAGGAACCAGTTTGGACTTGATTTTGAATCCCAGT
TCATCCCCTTCCTAGCTGTATGACCTTGATTGTGTGCCTTAACCGCTCTGTGACACAGTC
TACCTGTCTGCAAAATGGGAAACATAATACCTGCCATCAGGATTGTTGAGGAGTAAATAA
ATGGAAATTGGTG
gacgaggctgttaaccttctcttcaggtgggcgctgggacacaagagcatcgcagcttca
attctccccctaaaggtttgggggcagttggtgcagaggtgagaccagaagtgggaccac
aggaggtgtctatccaaaattccctccactctccatggtaaccagaactggagtcccacc