Gene CPT1C Variant 1
DNA : 22.58 KbNT_011109
mRNA : 2743 bp NM_152359
CDS : 2412 bp NP_689572
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  191 bp
gcggccaaatggtggagaatctggccgggtaaaaggagacggaggactggggatcgaacg
gatgtaggggattggacgccgtggctcgaagggggcggggatagaacgcggggattggaa
ggaggcggggataaaacccgggacctgaatacccggctagggacacgagagagaggaatc
GGGGTTTCTGGGTGACGGTGATCTCGGGGTGGGCAGGACTCCAAAGGCCCGTCGACCCGG
TGGTGGACTCCTTGCACTGGGATTGGACATATGCAAGCGGGAGATTTGGGGCCGGCGCTC
AAAATCGGGGGGCGGGGGTGGACTCGGGTTTGGACCCCAGGATCCGATCAGCGGACCCTT
GATTCAACGTG
gtaagtactggaccccaggggctcgggctccggcggggcctggagtcctgtgtctagggt
tgggcgtgcaagcctctccatcacttgtcctcgacgctcgcctccgctcacagcctcagc
atcccaggctgcgaggcatgcgcagtgggtgcttccttccccattccctccagcacgggc
EXON 2  155 bp
gggcctgggcttctgggtctgagggaggaggggctgggggcctggactcctggatctgag
agaggagggactggggcctggactcctgggtatgaaggaggaggaggggctgggggcctg
gactcctgagtctgagggcggaggggctggggtcctgaagtatgactctgcccgactcag
GGCTCCAGCGTGACATGGCTGAAGCGCACCAGGCCGTGGGCTTCCGACCCTCGCTGACCT
CGGACGGGGCTGAAGTGGAACTCAGTGCCCCTGTGCTGCAGGAGATCTACCTCTCTGGCC
TGCGCTCCTGGAAAAGGCATCTCTCACGTTTCTGG
gtgaggagcggtgctggtcggtttccttccggggatccaggtttctgcttccgggatgtc
tgaggctcacttccggcatttcagctggttcatttctgggagactatcacccctttttct
tagaattttgatgtctgctcccaggacccctttagcaatttctccgtggctcacttctgg
EXON 3  140 bp
ttacttcattctggtctgacctcgctgagggcaggacctggatctctctgttccctacta
gatcttgagcctccagctcagggctccgcactgggtgctcagtaatgtctggggatggca
cagaacaggggctcagaggagagggcagatgattcaatggatgccctttcctccccacag
AATGACTTTCTCACCGGTGTGTTTCCTGCCAGCCCCCTCAGTTGGCTTTTCCTCTTCAGT
GCCATCCAGCTTGCCTGGTTCCTCCAGCTGGATCCTTCCTTAGGACTGATGGAGAAGATC
AAAGAGTTGCTGCCTGACTG
gtgaggtccccccactccagcccagtaacccccaatcactctcccttcacccagtaagtt
cctctgtcattgtggtgtacctgctaaagaaaagtaacctctgagacttacattgggtca
gattaataaaggcatggcatgaagaaaaaggaggtgaggccgggcacagtggctcacccc
EXON 4  172 bp
ggtgctgccacaatgggagggggctggagggggtgacagagctcacacctactaaaatga
caaaaatgggtttctctgtctgacagccaaaagatcagcgcaggggctggagggggctgg
aagggagggaggttctgaggccaggagacccaggcccagcctctgtttctctccccgcag
GGGTGGACAACACCACGGGCTCCGGGGGGTCCTGGCAGCCGCGCTGTTTGCCTCGTGTTT
GTGGGGAGCCCTGATCTTCACACTGCACGTGGCCCTGAGGCTGCTTCTGTCCTACCACGG
CTGGCTTCTTGAGCCCCACGGAGCCATGTCCTCCCCCACCAAGACCTGGCTG
gtatgggaggggcatagccctgctcaggctctcctgggacccgcttatctattcccctct
ctctgggtctctgtccccctctctctgggtctctgtccctctctctctgggtctcttccc
cctctctttctgggtctctgtcctcctctgtccctgggtctctgtccccctctctctggg
EXON 5  102 bp
ccctctctctgggtctctgtcccctgtctctgggtctctgttcctttctctcttggggtc
tccgatgctcttaagtctctgtgtccttctctttgggtttctgtcccactgtcgacccct
gccccgtcaactccctggctccggtgaggggttaatgacccggtaactcctcctccccag
GCCCTGGTCCGCATCTTCTCTGGCCGCCACCCGATGCTGTTCAGTTACCAGCGCTCCCTG
CCACGCCAGCCCGTGCCCTCTGTGCAGGACACCGTGCGCAAG
gtgggcctgggagcgcgcagacgggctggggcggccggggcgggccgggggcgtgacctg
ccctcttctcccctttagtacctggagtcggtccggcccatcctctccgacgaggacttc
gactggaccgcggtcctggcgcaggaattcctgaggctgcaggcgtcgctgctgcagtgg
EXON 6  138 bp
gccctggtccgcatcttctctggccgccacccgatgctgttcagttaccagcgctccctg
ccacgccagcccgtgccctctgtgcaggacaccgtgcgcaaggtgggcctgggagcgcgc
agacgggctggggcggccggggcgggccgggggcgtgacctgccctcttctcccctttag
TACCTGGAGTCGGTCCGGCCCATCCTCTCCGACGAGGACTTCGACTGGACCGCGGTCCTG
GCGCAGGAATTCCTGAGGCTGCAGGCGTCGCTGCTGCAGTGGTACCTGCGGCTCAAGTCC
TGGTGGGCGTCCAATTAT
gtgagtcccgccaccgccaccaacgccccacctgaagggctaaggttgtgagctcgcctg
ctaaacttgcgagttatacgccctgccccacgacacgcccacaacccacacgcccccagc
ccccaagggtcaataccctgagccccgctcacatacatctatatcctaacctccacattt
EXON 7  78 bp
gctaactgatcccccatggatggatttctaggtgatcgctagttactgactacgatggct
gacttctttggctctatcctccctgcctgacgcaggagcatctggggccttccctgtcct
actgtccctcccccaacaggccccagcccctcactgtgtgtctccccaccccgctcccag
GTCAGTGACTGGTGGGAGGAATTTGTGTACCTGCGCTCCCGAAATCCGCTGATGGTGAAC
AGCAACTATTACATGATG
gtgagaaggggaggggtgaggttcataggccccaggtctagggttggggggtacctgggc
ggaatgtgacggtcatgctcagtgacctggatctagacgcgccatctgggattcatcatt
ccaccctcttttggggtcaggacctgtatttgggtcagtggctccatcgggggcaaacct
EXON 8  108 bp
agggttggggggtacctgggcggaatgtgacggtcatgctcagtgacctggatctagacg
cgccatctgggattcatcattccaccctcttttggggtcaggacctgtatttgggtcagt
ggctccatcgggggcaaacctgaccctgggtgttttgccatcccctctcctggtccccag
GACTTCCTGTATGTCACACCCACGCCTCTGCAGGCAGCTCGCGCTGGGAATGCCGTCCAT
GCCCTCCTCCTGTACCGCCACCGCCTGAACCGCCAGGAGATACCCCCG
gtgagagggccccagtgggttagggatggaggtgtggtcctgtggcctttgggccacgtg
ggtcctggaaggcagctcacagcccacggtttcctgcagactttgctgatgggaatgcgc
cccttatgctctgcccagtacgagaagatcttcaacaccacgcggattccaggggtccaa
EXON 9  85 bp
ctgcaggcagctcgcgctgggaatgccgtccatgccctcctcctgtaccgccaccgcctg
aaccgccaggagatacccccggtgagagggccccagtgggttagggatggaggtgtggtc
ctgtggcctttgggccacgtgggtcctggaaggcagctcacagcccacggtttcctgcag
ACTTTGCTGATGGGAATGCGCCCCTTATGCTCTGCCCAGTACGAGAAGATCTTCAACACC
ACGCGGATTCCAGGGGTCCAAAAAG
gtgagaccctctcctgtccccactgatggaggcagaacaatatagtggctaagagcatgt
tttctggagtccgcctgactgagctgggaaccattgcttccttgctgtgtgaccttctgc
acgttattaccctctctgagcctcagcttccactaaagtgggataataattgtacctagg
EXON 10  196 bp
cagcctggcgacagagcgagaccttgtctccaaatactaagtaaataaaagtcctagggt
gctgatgattactagggtactttgaacaactgacgacacctaagaagtatataataaatg
gtcactatttttatgtgtctggccttcctgcccccatgcttctgccaacgccacccctag
ACTACATCCGCCACCTCCATGACAGCCAACACGTGGCTGTCTTCCACCGGGGCCGATTCT
TCCGCATGGGGACCCACTCCCGAAACAGCCTGCTTTCCCCGAGAGCCCTGGAGCAGCAGT
TTCAGAGAATCCTGGATGATCCCTCACCGGCCTGCCCCCACGAGGAACATCTGGCAGCTC
TGACAGCTGCTCCCAG
gtaagggtcaggggtcaggggtcaggggctctcagaggccgccagtgtcctgagactgtg
gaagggcagggtggggccaggtggcggctgggcaggatggactcaggcacatcccgggcc
ctccaggggcacgtgggcccaggtgcggacatccctgaagacccaggcagcggaggccct
EXON 11  183 bp
ctcaccggcctgcccccacgaggaacatctggcagctctgacagctgctcccaggtaagg
gtcaggggtcaggggtcaggggctctcagaggccgccagtgtcctgagactgtggaaggg
cagggtggggccaggtggcggctgggcaggatggactcaggcacatcccgggccctccag
GGGCACGTGGGCCCAGGTGCGGACATCCCTGAAGACCCAGGCAGCGGAGGCCCTGGAGGC
GGTGGAAGGGGCCGCTTTCTTTGTGTCACTGGATGCTGAGCCCGCGGGGCTCACCAGGGA
GGACCCGGCAGCGTCGTTGGATGCCTACGCCCATGCTCTGCTGGCCGGCCGGGGCCATGA
TCG
gtgagtgagtcttgggatggggcccccagatgtggcacccgagaatccagtatcagacct
aggacccctgacagtagacagccagaccctggagcccacacctgcagagtctgtagacca
ggggctgcatagagctgaggaccccagacccagtgctttgggacctggagacctctgacc
EXON 12  106 bp
gtcttggagacctccagggccactactggggacccccaatggtcctagagatccccatac
cagcaccccaatggattcccacatcttcccatctagaaaaccccctcaagtcccacagaa
agcactctgaggtccccgtgcccctcgctcttggtgacccatctgaactctccctgacag
CTGGTTTGACAAATCCTTCACCCTAATCGTCTTCTCTAACGGGAAGCTGGGCCTCAGCGT
GGAGCACTCCTGGGCCGACTGCCCCATCTCAGGACACATGTGGGAG
gtagggcggccagccctccctggttctggggacccctgccccatctccaaagaccgtcct
ctccagcgccttagtgtcagaagaaaaactgaggcttggccgggcacggtggttcatgcc
tgtaatcccagcattttgggaggccgaggtgggcggatcatgaggtcaggagttcgagac
EXON 13  117 bp
ttggtgttagtcctgttcttgatgaacatgaacctgagaccgcatctgtgaatatcagag
gtttctgtttctcagggactgccccctacccgaaaaagggctgcatgaaaagaggtcccg
ggttagatggcctcagtccacagggaggaagggactctaacagcctctgtttgcccacag
TTCACTCTGGCTACAGAATGCTTTCAGCTGGGCTACTCAACAGACGGCCACTGCAAGGGG
CACCCGGACCCCACACTACCCCAGCCCCAGCGGCTGCAATGGGACCTTCCAGACCAG
gtgaggctgggtttctgggcctctcctccaagtcccaagattcctagccttgacttcaaa
ctcatccccacccctaatctgaacgtgaaaatcaaccccattcctacccccaacccgaaa
cccatgcttcccccacccccaaatcaggccatatgcatccacaacctcaaaccccaacac
EXON 14  165 bp
gcccagcccctatccccatctttagtctcatccttcaattctcttctcttctttgtcccc
atttccatattctgccgcaaccttaactccacatccacctccgcttccagccttattcct
ggctttcaccctacccccatctgtaaccccaactactcctcttccctcctcctctggcag
ATCCACTCCTCCATCTCTCTAGCCCTGAGGGGAGCCAAGATCTTGTCTGAAAATGTCGAC
TGCCATGTCGTTCCATTCTCCCTATTTGGCAAGAGCTTCATCCGACGCTGCCACCTCTCT
TCAGACAGCTTCATCCAGATCGCCTTGCAACTGGCCCACTTCCGG
gtcagttgggttccccatccacagcccccgcagggtctcagtccacctgagcccccaaga
cctgcccctccacggttccttgtggtcgctgccattgtgggtcggccatcttgaattctc
tcttccaaccattcttgggctggctggaggaggctggaggtctggacagagataggtcaa
EXON 15  135 bp
gacctgcccctccacggttccttgtggtcgctgccattgtgggtcggccatcttgaattc
tctcttccaaccattcttgggctggctggaggaggctggaggtctggacagagataggtc
aagtctgtaagatctcctgagcccagctgacagactcctcttctcctccctgtcccccag
GACAGGGGTCAATTCTGCCTGACTTATGAGTCGGCCATGACTCGCTTATTCCTGGAAGGC
CGGACGGAGACGGTGCGGTCTTGCACGAGGGAGGCCTGCAACTTTGTCAGGGCCATGGAG
GACAAAGAGAAGACG
gtgggtgcagccctcgcttgaggcttcagttatttctgtgtactcactcatccacttgca
aacgttgatgggacctactgaagccagcctccacgaggagcacaagggacaagggatgaa
tcggacctggcctctgacttcaaagagctcactgatggggggagacagcccagcatagtg
EXON 16  153 bp
gtgtgaacctggccaaatgatttcccctctctaagcctcagttccccatctgtaaaatgg
ggttgatattcccaccttgcagggatgtggcaaactcagttgaggccagatgtgccgcag
gcccagccctaagtcgacttcctgtctttccatgacctgtgacctccctggggactgcag
GACCCACAGTGCCTCGCCCTGTTCCGCGTGGCAGTGGACAAGCACCAGGCTCTGCTGAAG
GCAGCCATGAGCGGGCAGGGAGTTGACCGCCACCTGTTTGCGCTGTACATCGTGTCCCGA
TTCCTCCACCTGCAGTCGCCCTTCCTGACCCAG
gttggggcacagggaaagggttagagagggaagtgggagaccatggaagaagggagaggt
ttcagggaaggagggtgatgttgaaaaaggacccatcaaggccgggcacggtggctcacg
cctgtaatcccagcagtttgggaagccgaggcaggcggatcacttgaggtcaagagttcg
EXON 17  114 bp
gtggtgagacgagtgaggggcgtggccagatagggcgtggtcaggagaagggcgtggtta
gggagaaggaggcccggatttacgggtaaaaaaaaagccagggatgcagggagtgaagtg
gagccaagggccggaactgcagatctctgtcctgcacatgtgatgggctcctgtcctcag
GTCCATTCGGAGCAGTGGCAGCTGTCCACCAGCCAGATCCCTGTTCAGCAAATGCATCTG
TTTGACGTCCACAATTACCCGGACTATGTTTCCTCAGGCGGTGGATTCGGGCCT
gtgagtggagctgggcgcgctggcccccagaggaaagagggggctggggggcctgcactc
ctgcatagtgggggtggaggggaccggagctattttcttcccttcactctttccgtctcc
aggctgatgaccatggttatggtgtttcttatatcttcatgggggatggcatgatcacct
EXON 18  93 bp
tctgtttgacgtccacaattacccggactatgtttcctcaggcggtggattcgggcctgt
gagtggagctgggcgcgctggcccccagaggaaagagggggctggggggcctgcactcct
gcatagtgggggtggaggggaccggagctattttcttcccttcactctttccgtctccag
GCTGATGACCATGGTTATGGTGTTTCTTATATCTTCATGGGGGATGGCATGATCACCTTC
CACATCTCCAGCAAAAAATCAAGCACAAAAACG
gtgagacaaacgtgtatacccaccaactccctctttcctcaggaaccaggagtctgggcc
cccagcccctcctccctcagacccaggattccaggccccagcccctcctccctcagaccc
aggagtccaggcccccagcccctcctccctcagacccgggagtccaggcccccagcccct
EXON 19  312 bp
cccctcctccctcagacccgggagtccaggcccccagcccctcctccctcagactcggga
gtccaggccccagctcctcctccctcagactcaggaatccaggcccttagccctcttgtt
tctcagcctccaggatcccatctcccagcttcccctggctctgacctgttctccttccag
GATTCCCACAGGCTGGGGCAGCACATTGAGGACGCACTGCTGGATGTGGCCTCCCTGTTC
CAGGCGGGACAGCATTTTAAGCGCCGGTTCAGAGGGTCAGGGAAGGAGAACTCCAGGCAC
AGGTGTGGATTTCTCTCCCGCCAGACTGGGGCCTCCAAGGCCTCAATGACATCCACCGAC
TTCTGACTCCTTCCAGCAGGCAGCTGGCCTCTCCAAGGAATAAGGGTGAAATTGCCACAG
CTGGCTGACACAGGACAGGGGCAACTGGTTTGGCAACCCCACATCCAGGCCAATAAAGAT
GTGTGAGCTGGG
tgtgtggtgtctgctatgctcttgggcagggcaggggtagaagaggtaaggaccagggtg
gaggaggacagaagctcccatccattcccaggcccagccagggattcccagttgcagtca
cagcttcaaccacagcccgcaacacctgcccagtgtacttcatttccagcttcactcata