Gene CD37 Variant 1
DNA : 5.07 KbNT_011109
mRNA : 1125 bp NM_001774
CDS : 846 bp NP_001765
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  132 bp
cagagcatgtgtcccagtggagcaggtgagggagacagggacagagagagagacagaaag
ccaccttacatgaagcgggagtgggtggagccccacccctggaacttcctcttttggggt
tcttcctttctctctcagctctccgtctctctttctctctcagcctctttctttctccct
GTCTCCCCCACTGTCAGCACCTCTTCTGTGTGGTGAGTGGACCGCTTACCCCACTAGGTG
AAGATGTCAGCCCAGGAGAGCTGCCTCAGCCTCATCAAGTACTTCCTCTTCGTTTTCAAC
CTCTTCTTCTTC
gtgagttgcctcatggctacccagccggggcccagcccctgccgctaacccagccctcat
cttcccctgtggcccacccccgtatccgcatctcctctccccaggtcctcggcagcctga
tcttctgcttcggcatctggatcctcattgacaagaccagcttcgtgtcctttgtgggtg
EXON 2  73 bp
ggtgaagatgtcagcccaggagagctgcctcagcctcatcaagtacttcctcttcgtttt
caacctcttcttcttcgtgagttgcctcatggctacccagccggggcccagcccctgccg
ctaacccagccctcatcttcccctgtggcccacccccgtatccgcatctcctctccccag
GTCCTCGGCAGCCTGATCTTCTGCTTCGGCATCTGGATCCTCATTGACAAGACCAGCTTC
GTGTCCTTTGTGG
gtgaggggggctggggcaggtgggagggcctcccccaacccaagcaacttcctggggtct
cccttgtctcagggagacctacggtgccctactctgcaggcaggctacaggctcccatcc
actgctcaccggaggcttcttggagcctgagtcttcttccggcaaatggggttgtgcata
EXON 3  125 bp
aggcccagaaagaagagaaagtttcagaaggaaacagggactcagggtggggcagggaca
gagtcccagagagaggggcaccaagatactgctccccacttgggtggctgcctaggtggg
aaatggggctgcctggagctgtgccacacagctcatcatcactcccctcacctctcccag
GCTTGGCCTTCGTGCCTCTGCAGATCTGGTCCAAAGTCCTGGCCATCTCAGGAATCTTCA
CCATGGGCATCGCCCTCCTGGGTTGTGTGGGGGCCCTCAAGGAGCTCCGCTGCCTCCTGG
GCCTG
gtgagtgcaccatccctctccgtccctaggaacactcctatccccaccctcaaaaatggc
ctgggccggggttgcaggggtggtcagcctgatctctccactctgctccccagtattttg
ggatgctgctgctcctgtttgccacacagatcaccctgggaatcctcatctccactcagc
EXON 4  75 bp
caccatgggcatcgccctcctgggttgtgtgggggccctcaaggagctccgctgcctcct
gggcctggtgagtgcaccatccctctccgtccctaggaacactcctatccccaccctcaa
aaatggcctgggccggggttgcaggggtggtcagcctgatctctccactctgctccccag
TATTTTGGGATGCTGCTGCTCCTGTTTGCCACACAGATCACCCTGGGAATCCTCATCTCC
ACTCAGCGGGCCCAG
gtgagcttcctgcagtggccaccacccacccccagcagggaggagagggaagggagtggt
gggagagggtggagagagaccgaaacaagggcagacaggggctaacctagataaagagaa
ataagaggctgggcctggtggctcacgcctgtaatcccataatcccagcactttgggagg
EXON 5  105 bp
tgagccgtagaaatagtggaagaaacagaaagacagacctgaagtacacagagctagcca
ttcagtaaggatttgagactggcccagagatgcacagggcccgcctgaggctggcacagc
ctgagagggggaggggtggggcggggaagataaggcccagcctcactggtggcctctcag
CTGGAGCGAAGCTTGCGGGACGTCGTAGAGAAAACCATCCAAAAGTACGGCACCAACCCC
GAGGAGACCGCGGCCGAGGAGAGCTGGGACTATGTGCAGTTCCAG
gtaagcccccctcctccagttccctcccggactgacccgcctcagccctgtgcttggagg
agactccaccccaacgtgggcccgacccccagctctacgatcctaacacaccccaatccc
tcccaggcccgacgctccccactccccagatgacacaactgtccccggcgtcgcctggtc
EXON 6  237 bp
tgttcccgtaatgtcccctggctccggccccatcgtgaccccagcccactgtcccccact
ccacacccaccacttagtcccctgctccccgacctgacctcatacccatcaccttgtccc
ctgatccccaacatcatatgtctccagtcccggtccctctgactcgtatccctctcccag
CTGCGCTGCTGCGGCTGGCACTACCCGCAGGACTGGTTCCAAGTCCTCATCCTGAGAGGT
AACGGGTCGGAGGCGCACCGCGTGCCCTGCTCCTGCTACAACTTGTCGGCGACCAACGAC
TCCACAATCCTAGATAAGGTGATCTTGCCCCAGCTCAGCAGGCTTGGACACCTGGCGCGG
TCCAGACACAGTGCAGACATCTGCGCTGTCCCTGCAGAGAGCCACATCTACCGCGAG
gtgggcaggggttcggagcataaacctgtcgaatggggcggggcctgcgggagggggagg
gctgtcagtgagtagcggcctgagaaagggcggggtctacgagaaaaggaaaggtacggc
aggaggggcggggccctctgaagggggcggggtctgcaggaagggcagggcctaaagaaa
EXON 7  84 bp
ggaggggccaggcttggaaaaggtgaagcgagggtgcactagtaaggagactagagtgcc
ctggtgactaggggagcgggtagatgcctgaagacggtgagggttggcctgaaaagaacg
ctgggcctgggcttgagagtcccagaaagaatccctttaacttttccctacaccccccag
GGCTGCGCGCAGGGCCTCCAGAAGTGGCTGCACAACAACCTTATTTCCATAGTGGGCATT
TGCCTGGGCGTCGGCCTACTCGAG
gtgatctggccccgcccccacccgcgatcggccctaaatccctagatggccctgcccttc
atttcgcgtccttcggttgcctgggaaggacgagctcagggcggagcgcagcccaccccg
gccctcccgccgctccacccagcaccggagggtgggggcggcccagcttcagggagccct
EXON 8  294 bp
ctcatcagccagccctgcggcagttcccgtcgagccccgcccttttctacctatcccctt
ctccagccccttcccgcccaattcacggccccacccctgacctttctcgcccgggtgggc
atcacccccgtctcgccagcaccccttcgacttctctgacctcatctcctttctctatag
CTCGGGTTCATGACGCTCTCGATATTCCTGTGCAGAAACCTGGACCACGTCTACAACCGG
CTCGCTCGATACCGTTAGGCCCCGCCCTCCCCAAAGTCCCGCCCCGCCCCCGTCACGTGC
GCTGGGCACTTCCCTGCTGCCTGTAAATATTTGTTTAATCCCCAGTTCGCCTGGAGCCCT
CCGCCTTCACATTCCCCTGGGGACCCACGTGGCTGCGTGCCCCTGCTGCTGTCACCTCTC
CCACGGGACCTGGGGCTTTCGTCCACAGCTTCCTGTCCCCATCTGTCGGCCTAC
caccacccacaagattatttttcacccaaacctcaaataaatcccctgcgtttttggtaa
aatagctttatcctctgtcagaacacaaacaaacaaactttgagaggggaggaaggaaac
cgtctagctcagggctcacttaggagagggatgagattagaaagttcaacacactgcttg