Gene CD22 Variant 1
DNA : 18.15 KbNT_011109
mRNA : 3248 bp NM_001771
CDS : 2542 bp NP_001762
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  22 bp
gactccgagcccgcatccccctcaatcgtctcttttccccactccccagatcacggtgct
gcttggtccccctcagagccatagagaagcagggggtgtggccatggaggggaaacctct
gtcaccagagactttactgtacttctccttttgctctcagatgctgccagggtccctgaa
GAGGGAAGACACGCGGAAACAG
gtaaaaatcattttgcttttattttgcattcaacaagcaagttattacggaacagcagtt
atgggccaggcatacctcccagagctgggaacacagtggggacctccctggctctctctt
accggtgttacaacaggttgtagacagacccctgtcttgagcatcctccttgccaggcct
EXON 2  56 bp
tctgtctcaaaaaaaaagaaagaactccgtgagcatcccaaatgccacatccccataatg
caaccagacccggtcctcccggatccaggggaagggtcggagctcagtgggtgagcaaga
aaagccacgtggaagaagtaagcggccagatggctcaaagacaaactctcccctgctcag
GCTTGCACCCAGACACGACACCATGCATCTCCTCGGCCCCTGGCTCCTGCTCCTGG
gtaaggactgtggcctgggctagtactggggttctgggatgtcagtgggcactggaggag
gaggaaagacccaggcagagaggcgtcaacatagggtagggtgggggcagcggtgtgtat
agataaatgtacatacaaatatatatgtttcccatatatacatacacttctctcattgca
EXON 3  378 bp
tttgtgaggctgaggtgggaggatcacttgaggtcaggagttcaaggccagcttggacaa
catagcaagacccctatctctaaaaagaataaaaaattaaacaaattttaaaataaaaaa
taacttttaaaagaaggctctcatgcccccttagtaatgctttctgatcactgtggtgag
TTCTAGAATACTTGGCTTTCTCTGACTCAAGTAAATGGGTTTTTGAGCACCCTGAAACCC
TCTACGCCTGGGAGGGGGCCTGCGTCTGGATCCCCTGCACCTACAGAGCCCTAGATGGTG
ACCTGGAAAGCTTCATCCTGTTCCACAATCCTGAGTATAACAAGAACACCTCGAAGTTTG
ATGGGACAAGACTCTATGAAAGCACAAAGGATGGGAAGGTTCCTTCTGAGCAGAAAAGGG
TGCAATTCCTGGGAGACAAGAATAAGAACTGCACACTGAGTATCCACCCGGTGCACCTCA
ATGACAGTGGTCAGCTGGGGCTGAGGATGGAGTCCAAGACTGAGAAATGGATGGAACGAA
TACACCTCAATGTCTCTG
gtaaggccttcggggagcgggtcctctgctctgggcaggggtgagtgggaggcaggaaat
acctgactcctggcacagagctcacaaaccgagcttcctgcagagctcaggcaggggacg
ccagcggatgacgatggcgatgcagcagcactagacagagctgcgggacctcggatgtcc
EXON 4  306 bp
aaaaaacaacaacacaacaacaacaacaataacaacaaaaaaacaaagcaggactggaga
gaggtggaatgaagtggcaaggggttcctgaggggtgatttgggacaggacatctaaagc
caggtgtacgctcacgtcctcagtcccccaggctcctgcacgggctctgttcttttgcag
AAAGGCCTTTTCCACCTCATATCCAGCTCCCTCCAGAAATTCAAGAGTCCCAGGAAGTCA
CTCTGACCTGCTTGCTGAATTTCTCCTGCTATGGGTATCCGATCCAATTGCAGTGGCTCC
TAGAGGGGGTTCCAATGAGGCAGGCTGCTGTCACCTCGACCTCCTTGACCATCAAGTCTG
TCTTCACCCGGAGCGAGCTCAAGTTCTCCCCACAGTGGAGTCACCATGGGAAGATTGTGA
CCTGCCAGCTTCAGGATGCAGATGGGAAGTTCCTCTCCAATGACACGGTGCAGCTGAACG
TGAAGC
gtgagtctccccggcatgcctgtgggaagggcaaggtctgtgtcaccttctccccagccc
cgcagggggcatgcacccagggcagggggaagcctgcacagacggcggcatcctccagcc
ctggtcacgccgccttgtcagccctggtgtttcgggaaaaagatttgctctagcctaaca
EXON 5  267 bp
ggagaccaagaagtagaggaagtgggagggggaagctgagagccgagttaggaggctgtg
accatcacctgggtgaagggactggcaggccatggctttgtcagaataaaagcactttcc
acaccctccaccctctgaggattccccgccccctccccgactgcccctctgctcctccag
ACACCCCGAAGTTGGAGATCAAGGTCACTCCCAGTGATGCCATAGTGAGGGAGGGGGACT
CTGTGACCATGACCTGCGAGGTCAGCAGCAGCAACCCGGAGTACACGACGGTATCCTGGC
TCAAGGATGGGACCTCGCTGAAGAAGCAGAATACATTCACGCTAAACCTGCGCGAAGTGA
CCAAGGACCAGAGTGGGAAGTACTGCTGTCAGGTCTCCAATGACGTGGGCCCGGGAAGGT
CGGAAGAAGTGTTCCTGCAAGTGCAGT
gtgagcccctcggagctggggacaggccaggcagggaggtagcaggggtggacccggaga
ggggagccacgggggctctcggggccgtgtgcacaggttgggggtgctctcctcacccct
ccactcgcctctgccccctcttccagatgccccggaaccttccacggttcagatcctcca
EXON 6  262 bp
ggaaggtcggaagaagtgttcctgcaagtgcagtgtgagcccctcggagctggggacagg
ccaggcagggaggtagcaggggtggacccggagaggggagccacgggggctctcggggcc
gtgtgcacaggttgggggtgctctcctcacccctccactcgcctctgccccctcttccag
ATGCCCCGGAACCTTCCACGGTTCAGATCCTCCACTCACCGGCTGTGGAGGGAAGTCAAG
TCGAGTTTCTTTGCATGTCACTGGCCAATCCTCTTCCAACAAATTACACGTGGTACCACA
ATGGGAAAGAAATGCAGGGAAGGACAGAGGAGAAAGTCCACATCCCAAAGATCCTCCCCT
GGCACGCTGGGACTTATTCCTGTGTGGCAGAAAACATTCTTGGTACTGGACAGAGGGGCC
CGGGAGCTGAGCTGGATGTCCA
gtgtgagtagccacggagcctctggttctagggagagaagatggacacagggaacgggga
aggcagatggggtgcagggcattccggggtcctggagtcaagagcaaggagcagccaggg
tctcctgttcacaactgctgtctcagctcctagcatagggcctggctcatggagggtgct
EXON 7  258 bp
gagagccagggcagggtttctgttctcacacagatgcaggaaggacgcacaagcccccct
ttgattaatttaggacctgtgcagatgcccgggacaggtagcgggagaagaggaagcagg
agggaaggggtactgtggacagctggcttttctttactcacctctctggttttcttccag
ATCCTCCCAAGAAGGTGACCACAGTGATTCAAAACCCCATGCCGATTCGAGAAGGAGACA
CAGTGACCCTTTCCTGTAACTACAATTCCAGTAACCCCAGTGTTACCCGGTATGAATGGA
AACCCCATGGCGCCTGGGAGGAGCCATCGCTTGGGGTGCTGAAGATCCAAAACGTTGGCT
GGGACAACACAACCATCGCCTGCGCAGCTTGTAATAGTTGGTGCTCGTGGGCCTCCCCTG
TCGCCCTGAATGTCCAGT
gtgagtccctgggctaggcagggggatctgggaggtggcccggctgggatgaggggatga
aggcaacgaggccggagcctgggccagtgtcttcaacagaattgagggacaggagcctgg
cgtcagggccaaggggaggggaggcctggggacagcaaaagggacagggagcggagaggt
EXON 8  264 bp
gatctgggaggtggcccggctgggatgaggggatgaaggcaacgaggccggagcctgggc
cagtgtcttcaacagaattgagggacaggagcctggcgtcagggccaaggggaggggagg
cctggggacagcaaaagggacagggagcggagaggtcagcttgggacccttgccctccag
ATGCCCCCCGAGACGTGAGGGTCCGGAAAATCAAGCCCCTTTCCGAGATTCACTCTGGAA
ACTCGGTCAGCCTCCAATGTGACTTCTCAAGCAGCCACCCCAAAGAAGTCCAGTTCTTCT
GGGAGAAAAATGGCAGGCTTCTGGGGAAAGAAAGCCAGCTGAATTTTGACTCCATCTCCC
CAGAAGATGCTGGGAGTTACAGCTGCTGGGTGAACAACTCCATAGGACAGACAGCGTCCA
AGGCCTGGACACTTGAAGTGCTGT
gtgagtgagggccggaggctgggagtggagcagagaagggaccagtggcctgcctggtag
tgacttcgcaccccctccccctgcccgccatgcagatgcacccaggaggctgcgtgtgtc
catgagcccgggggaccaagtgatggaggggaagagtgcaaccctgacctgtgagagcga
EXON 9  264 bp
ccagaagatgctgggagttacagctgctgggtgaacaactccataggacagacagcgtcc
aaggcctggacacttgaagtgctgtgtgagtgagggccggaggctgggagtggagcagag
aagggaccagtggcctgcctggtagtgacttcgcaccccctccccctgcccgccatgcag
ATGCACCCAGGAGGCTGCGTGTGTCCATGAGCCCGGGGGACCAAGTGATGGAGGGGAAGA
GTGCAACCCTGACCTGTGAGAGCGACGCCAACCCTCCCGTCTCCCACTACACCTGGTTTG
ACTGGAATAACCAAAGCCTCCCCTACCACAGCCAGAAGCTGAGATTGGAGCCGGTGAAGG
TCCAGCACTCGGGTGCCTACTGGTGCCAGGGGACCAACAGTGTGGGCAAGGGCCGTTCGC
CTCTCAGCACCCTCACCGTCTACT
gtaaggcctcttcctgctcttgttcttcttggtggtggtcagtccttccttccttccttc
cttccttccttccttccttccttccttcctttctttctctctttcttttcctcctcctct
tcttcccctcctcctcctcttcctccttcttcttcttcttctgctttctccctctcctcc
EXON 10  97 bp
ctaaagggaggcccagagcaagcaggggccgttgtcaccctcttcctctgcacccctgca
cgcatgcaggggagaaggacgagtctggctgcagagagaagtccaggatgccttccaggc
aaaggctgccagggagagctggcccctcagttgattaaggtctctcctttctccacccag
ATAGCCCGGAGACCATCGGCAGGCGAGTGGCTGTGGGACTCGGGTCCTGCCTCGCCATCC
TCATCCTGGCAATCTGTGGGCTCAAGCTCCAGCGACG
gtgagctcctgccatcccccaccacctcctctatcccttggcagaggcccgtgtccagtt
gctccatctcgaagcctccagcctgtggagtccctgaccctcacacatgtgcctttattt
ctcagttggaagaggacacagagccagcaggggcttcaggagaattccagcggccagagc
EXON 11  76 bp
ggtcctgcctcgccatcctcatcctggcaatctgtgggctcaagctccagcgacggtgag
ctcctgccatcccccaccacctcctctatcccttggcagaggcccgtgtccagttgctcc
atctcgaagcctccagcctgtggagtccctgaccctcacacatgtgcctttatttctcag
TTGGAAGAGGACACAGAGCCAGCAGGGGCTTCAGGAGAATTCCAGCGGCCAGAGCTTCTT
TGTGAGGAATAAAAAG
gtaggatggggctgggcacgatggctcatgcctgtaatcccagcactttgggaggctgag
gcaggtggatcacctgaggtcaggagttcgagaccagcgtagccaacatggtgaaaccct
gtctctacaaaaaatattttaaaaattagccgggcgtgatggtccatgcctgtaattcca
EXON 12  119 bp
aaaaaaaaaaaaaaaaaaaaaaaagggtaggcatgaggcagactgtgaagctgagtgggg
aaacaaggtgaaggaaggggataaaatgtcctctgaggagacctgggctgtcagaggcca
gggaaggggacgagggttggggaacaggtggttagcacttcatcctcgtctccctcccag
GTTAGAAGGGCCCCCCTCTCTGAAGGCCCCCACTCCCTGGGATGCTACAATCCAATGATG
GAAGATGGCATTAGCTACACCACCCTGCGCTTTCCCGAGATGAACATACCACGAACTGG
gtactgagggtaccaggagggtgaccctgcaccctgggagggaggcgggaggaaaagctc
tgtcccgcctgccctctttgtgccaggcccatgccaggcaccctgatacatgctctgcct
cattcccactcggcaacaagcctctgggtaagggccagtctccagaagtggacctgctcc
EXON 13  85 bp
gcctactccctccacgcacatttgcacgagctcctactgtgagctttgggcactggggag
gccacaggttttacataaggggctgaggttggggtgctgttgggggctctgggtgttgag
agggaggagagttcgtgggagatgcttcatgcgtggtcgtctatctgccctgtctctcag
AGATGCAGAGTCCTCAGAGATGCAGAGACCTCCCCCGGACTGCGATGACACGGTCACTTA
TTCAGCATTGCACAAGCGCCAAGTG
gtaaggagggtctccccaggtctccccagaggggctgtggaaggctggggacagggcctg
gcctcagtggtgggtcccacataggaaggagttgggtaggcatccgtggtggcagaggtt
gggtgttggagacggttgctccggcagagctggccagagccaggcaggtacctccaggtc
EXON 14  794 bp
tggccagagccaggcaggtacctccaggtcctggatgccggccacagccagtttcctgac
acgaggacacccgcctgggcttttggacccccgggtggaatgaaggagagaatgcggaga
aaagcggcggtggaggctggcgacagtggggccaggctaaccaccatgcggttttctcag
GGCGACTATGAGAACGTCATTCCAGATTTTCCAGAAGATGAGGGGATTCATTACTCAGAG
CTGATCCAGTTTGGGGTCGGGGAGCGGCCTCAGGCACAAGAAAATGTGGACTATGTGATC
CTCAAACATTGACACTGGATGGGCTGCAGCAGAGGCACTGGGGGCAGCGGGGGCCAGGGA
AGTCCCCGAGTTTCCCCAGACACCGCCACATGGCTTCCTCCTGCGCGCATGTGCGCACAC
ACACACACACACGCACACACACACACACACACTCACTGCGGAGAACCTTGTGCCTGGCTC
AGAGCCAGTCTTTTTGGTGAGGGTAACCCCAAACCTCCAAAACTCCTGCCCCTGTTCTCT
TCCACTCTCCTTGCTACCCAGAAATCCATCTAAATACCTGCCCTGACATGCACACCTCCC
CCTGCCCCCACCACGGCCACTGGCCATCTCCACCCCCAGCTGCTTGTGTCCCTCCTGGGA
TCTGCTCGTCATCATTTTTCCTTCCCTTCTCCATCTCTCTGGCCCTCTACCCCTGATCTG
ACATCCCCACTCACGAATATTATGCCCAGTTTCTGCCTCTGAGGGAAAGCCCAGAAAAGG
ACAGAAACGAAGTAGAAAGGGGCCCAGTCCTGGCCTGGCTTCTCCTTTGGAAGTGAGGCA
TTGCACAGGGAGACGTACGTATCAGCGGCCCCTTGACTCTGGGGACTCCGGGTTTGAGAT
GGACACACTGGTGTGGATTAACCTGCCAGGGAGACAGAGCTCACAATAAAAATGGCTCAG
ATGCCACTTCAAAG
aaccagtgaactcttttcagtctgtggagtcagagtggggatgaggagaggggaaagtct
tcatggggcctggggggaaggaaatggagtcacagtggtttactgatcaaaccagcagat
tagagagtctggtgtcttgttaggaaaagcatactggctttgcagacagacaaacatgag