Gene CALR Variant 1
DNA : 5.88 KbNT_011295
mRNA : 1901 bp NM_004343
CDS : 1254 bp NP_004334
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  162 bp
ccatctgggaacccagcgttccgaggcgcagcctaacatagtgaaccgacgaaggtccaa
tggaaaaagacggccatgggcatagaccaatgacaaagtggcaggggcgggcccaagggc
tgggtcaggttggtttgagaggcgggtgggtataaaagtgcaaggcgggcggcggcgtcc
GTCCGTACTGCAGAGCCGCTGCCGGAGGGTCGTTTTAAAGGGCCCGCGCGTTGCCGCCCC
CTCGGCCCGCCATGCTGCTATCCGTGCCGCTGCTGCTCGGCCTCCTCGGCCTGGCCGTCG
CCGAGCCTGCCGTCTACTTCAAGGAGCAGTTTCTGGACGGAG
gtaacgcctggtcccgcctcgaggccgccccgacgacgcggccggcccccgatcctggat
ctgcgttgtcgcccgtaattaccgtttagaggtccaacacggtggcctcccgggactaga
gccgcgggcgatttctcttctgcgtccctggggagcgcggagggcgtagcggcctcccgc
EXON 2  102 bp
gggagttagggttagcccgaggatctctgaaggcacccgacgtgtcaaactagaggttgg
aatggggagtgtcggggatctcctttcctgtccccagcagcttgtggctctcggcagatg
tttggtgtggggggggattagcacagccgctctgacctacccctctaatcccccacttag
ACGGGTGGACTTCCCGCTGGATCGAATCCAAACACAAGTCAGATTTTGGCAAATTCGTTC
TCAGTTCCGGCAAGTTCTACGGTGACGAGGAGAAAGATAAAG
gtaagagcctaggagtgggtgctcagatccgggaggacttcctggcagaagtccttgtct
gtacacacacagccgggacagtccccttggaggaggacaggtggaggaagtgggggagtc
ttctctattctctaagtcgagggtcctcgcgagtcaaggcccaacggtgacctcactacc
EXON 3  204 bp
gagtgggtgctcagatccgggaggacttcctggcagaagtccttgtctgtacacacacag
ccgggacagtccccttggaggaggacaggtggaggaagtgggggagtcttctctattctc
taagtcgagggtcctcgcgagtcaaggcccaacggtgacctcactaccgtcccgtctcag
GTTTGCAGACAAGCCAGGATGCACGCTTTTATGCTCTGTCGGCCAGTTTCGAGCCTTTCA
GCAACAAAGGCCAGACGCTGGTGGTGCAGTTCACGGTGAAACATGAGCAGAACATCGACT
GTGGGGGCGGCTATGTGAAGCTGTTTCCTAATAGTTTGGACCAGACAGACATGCACGGAG
ACTCAGAATACAACATCATGTTTG
gtgagggcctgcttcctggtgctgatctctgtcccattagttagagggagacccagaccc
cattgactttcttaataatgattttttttggaaggggagctaaaagaataagtcccagca
acaatttattgcattatgatcgcagatctaggctgttaatttaatttgcgtgtttgtata
EXON 4  95 bp
tctcctttaaacttaaggctccacccacagcccattcaggacagaatcagggtctgagtt
tctcttctcagccttgacagacccgagttgaagaaccaggtcttccttttataaagaggg
gtgagagcctcgagatgatgggtagtctctgactcttaactggatctgcttcacacctag
GTCCCGACATCTGTGGCCCTGGCACCAAGAAGGTTCATGTCATCTTCAACTACAAGGGCA
AGAACGTGCTGATCAACAAGGACATCCGTTGCAAG
gtgtgcctgggggtggtggcaaatggctgtcatggggagattcagaggtcagcctcattg
gggggtggcccccgctcaccttcttccttcttcaggatgatgagtttacacacctgtaca
cactgattgtgcggccagacaacacctatgaggtgaagattgacaacagccaggtggagt
EXON 5  210 bp
ctgtggccctggcaccaagaaggttcatgtcatcttcaactacaagggcaagaacgtgct
gatcaacaaggacatccgttgcaaggtgtgcctgggggtggtggcaaatggctgtcatgg
ggagattcagaggtcagcctcattggggggtggcccccgctcaccttcttccttcttcag
GATGATGAGTTTACACACCTGTACACACTGATTGTGCGGCCAGACAACACCTATGAGGTG
AAGATTGACAACAGCCAGGTGGAGTCCGGCTCCTTGGAAGACGATTGGGACTTCCTGCCA
CCCAAGAAGATAAAGGATCCTGATGCTTCAAAACCGGAAGACTGGGATGAGCGGGCCAAG
ATCGATGATCCCACAGACTCCAAGCCTGAG
gttggtgtttgggcaggggctctgctctccacattggagggtgtggaagacatctgggcc
aactctgatctcttcatctaccccccaggactgggacaagcccgagcatatccctgaccc
tgatgctaagaagcccgaggactgggatgaagagatggacggagagtgggaacccccagt
EXON 6  114 bp
cacccaagaagataaaggatcctgatgcttcaaaaccggaagactgggatgagcgggcca
agatcgatgatcccacagactccaagcctgaggttggtgtttgggcaggggctctgctct
ccacattggagggtgtggaagacatctgggccaactctgatctcttcatctaccccccag
GACTGGGACAAGCCCGAGCATATCCCTGACCCTGATGCTAAGAAGCCCGAGGACTGGGAT
GAAGAGATGGACGGAGAGTGGGAACCCCCAGTGATTCAGAACCCTGAGTACAAG
gtgagtttggggctctgagcagggctggggctcacagtggggagtgcaccaaccttactc
acccttcggtttccttctcccttctgcagggtgagtggaagccccggcagatcgacaacc
cagattacaagggcacttggatccacccagaaattgacaaccccgagtattctcccgatc
EXON 7  144 bp
ccctgaccctgatgctaagaagcccgaggactgggatgaagagatggacggagagtggga
acccccagtgattcagaaccctgagtacaaggtgagtttggggctctgagcagggctggg
gctcacagtggggagtgcaccaaccttactcacccttcggtttccttctcccttctgcag
GGTGAGTGGAAGCCCCGGCAGATCGACAACCCAGATTACAAGGGCACTTGGATCCACCCA
GAAATTGACAACCCCGAGTATTCTCCCGATCCCAGTATCTATGCCTATGATAACTTTGGC
GTGCTGGGCCTGGACCTCTGGCAG
gtgagacttggaggaaaaaggaggatccctggggtacctcaagtgcataagatcacccaa
gaggaaagggacagggtaggcaccccaggtgagtctgactcaaaaatggtacttcttgta
aacagtacttcctggtctgtccctgtgaagtcctcacagcaacccctttaaggttatact
EXON 8  93 bp
ggcgtgatccacctcacctggcctctccatctttttaactgcagtgtcagcggtgttcct
tgtcttctctgcagatgcaggcagcagaatatagtggttataggaacacaggtggaaacc
ctgtccaaagcaagggctatcgggtatcacctctgaccatccttcccattcatcctccag
GTCAAGTCTGGCACCATCTTTGACAACTTCCTCATCACCAACGATGAGGCATACGCTGAG
GAGTTTGGCAACGAGACGTGGGGCGTAACAAAG
gtgaggcctggtcctggtcctgatgtcgggggcgggcagggctggcagggggcaaggccc
tgaggtgtgtgctctgcctgcaggcagcagagaaacaaatgaaggacaaacaggacgagg
agcagaggcttaaggaggaggaagaagacaagaaacgcaaagaggaggaggaggcagagg
EXON 9  777 bp
ccaggtcaagtctggcaccatctttgacaacttcctcatcaccaacgatgaggcatacgc
tgaggagtttggcaacgagacgtggggcgtaacaaaggtgaggcctggtcctggtcctga
tgtcgggggcgggcagggctggcagggggcaaggccctgaggtgtgtgctctgcctgcag
GCAGCAGAGAAACAAATGAAGGACAAACAGGACGAGGAGCAGAGGCTTAAGGAGGAGGAA
GAAGACAAGAAACGCAAAGAGGAGGAGGAGGCAGAGGACAAGGAGGATGATGAGGACAAA
GATGAGGATGAGGAGGATGAGGAGGACAAGGAGGAAGATGAGGAGGAAGATGTCCCCGGC
CAGGCCAAGGACGAGCTGTAGAGAGGCCTGCCTCCAGGGCTGGACTGAGGCCTGAGCGCT
CCTGCCGCAGAGCTGGCCGCGCCAAATAATGTCTCTGTGAGACTCGAGAACTTTCATTTT
TTTCCAGGCTGGTTCGGATTTGGGGTGGATTTTGGTTTTGTTCCCCTCCTCCACTCTCCC
CCACCCCCTCCCCGCCCTTTTTTTTTTTTTTTTTTAAACTGGTATTTTATCTTTGATTCT
CCTTCAGCCCTCACCCCTGGTTCTCATCTTTCTTGATCAACATCTTTTCTTGCCTCTGTC
CCCTTCTCTCATCTCTTAGCTCCCCTCCAACCTGGGGGGCAGTGGTGTGGAGAAGCCACA
GGCCTGAGATTTCATCTGCTCTCCTTCCTGGAGCCCAGAGGAGGGCAGCAGAAGGGGGTG
GTGTCTCCAACCCCCCAGCACTGAGGAAGAACGGGGCTCTTCTCATTTCACCCCTCCCTT
TCTCCCCTGCCCCCAGGACTGGGCCACTTCTGGGTGGGGCAGTGGGTCCCAGATTGGCTC
ACACTGAGAATGTAAGAACTACAAACAAAATTTCTATTAAATTAAATTTTGTGTCTC
cctcctgtgtctccttctggggaaagacagacttaaggaaacccagcagtggtctttttg
gggggggggggggtttccagtatatctcctttttcagctattgctagagaggttgctgag
tgttccacaagattccagggacccttatttaccccataaccctcaaaaccaacgggggaa