Gene CACNG6 Variant 3
DNA : 20.38 KbNT_011109
mRNA : 1635 bp NM_031897
CDS : 570 bp NP_114103
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  921 bp
cccttttcctgaattccagcgaggcccagtcctcttctgagccccagccagggctctgtt
cttctccttctgtggatgccggggtcctactgcctctcttgagacccggattgaattccg
acctccccttgggagcttcccgggaccccaggtcttccttttccgaatcccagagggtcc
CCAAGTCCTCTGTTCTCAAACTCTGAGCCCAAGGGAACCCCGGCCACATCTCCTCCAAAC
ACACACAGGACCTCAGGTCCCTTCCTGGGTACCCCAAACTCTTAGCCCTAGTGGGGTGCT
CAGATCTCTCAGGAAAACCAGTTTCCCTTTTGTTAACCCCCCAGCGGGGACCCCAAAGCA
GCCCCTTGGAGCTGCAGGGAGCTTCAGCGGGCACCAGTTCTCATTCCTCTGGAGCTCTTG
GGGGGACTCCCTCCTGGGAAGCCGAATTCTATCTCTAAACCTCAGGGTGGGGGCCTTGTT
TTTCCTCTGGGCCCCGTCTTCTTTGCCAAGTTCTTGAGGGCAACCTAGACCCTCCTCTGA
ACCCCAGAGGCTTCCCCAGCCCTGGGGATCATTTTTCTCTTCTGAACCCCAGAAGCAATC
TCGACTTTCGCATTTGAGATTCCAGACAGGACTCGGCTCTCCCTCTTTCATACCCAGGGG
AAACTGAGTCCCTCACCCCCTTCAAGACCCCAGGCCGCTCCTCGCTCCCGCCCCTCGAGG
CCCTTCGCCGGCTCTGCCTCCTCCCCCTTCCCGACCCCACCGGCCATAAGATGATGTGGT
CCAACTTCTTCCTGCAAGAGGAGAACCGGCGGCGGGGGGCCGCGGGCCGGCGGCGGGCGC
ACGGGCAGGGCAGGTCGGGGCTGACGCCCGAGCGCGAGGGGAAGGTGAAGCTGGCGCTGC
TGCTGGCCGCCGTGGGCGCCACGCTGGCGGTGCTGTCCGTGGGCACCGAGTTCTGGGTGG
AGCTCAACACCTACAAGGCCAACGGCAGCGCCGTGTGCGAAGCGGCCCACCTGGGGCTGT
GGAAGGCGTGCACCAAGCGGCTGTGGCAGGCGGACGTGCCCGTGGACAGGGACACCTGCG
GCCCCGCGGAGCTGCCCGGAG
gtgagcagccgccgccccgagcgcagggcttgcgtcccacggacagggagggagaggggc
ccgtgtccgaggagaaaacccgccccagggacaaaagcctgagcccggaggagacagctt
gcctcgcagtaagcgccagtgcccacttcgtcctctgctctcagaaactgctgagagata
EXON 2  714 bp
ttctttatctccagcttcccaaatgctgcctgctatatagtaggtgtttagtaagtattt
gttgagtgcacgcgtgggaaggtgccagggtgggcgggagggctgggagcggatggcgga
gatgttcagacacagctggggtcgcgggcgtctgactgcgagctgtcctctctcccgcag
GCCTGCTGCTCTTGGTGAGCCTGGAGGTGTTCCGGCATTCCGTGAGGGCCCTGCTGCAGA
GAGTCAGCCCGGAGCCTCCCCCGGCCCCACGCCTCACCTACGAGTACTCCTGGTCCCTGG
GCTGCGGCGTGGGGGCCGGCCTGATCCTGCTGTTGGGGGCCGGCTGCTTTCTGCTGCTCA
CACTGCCTTCCTGGCCCTGGGGGTCCCTCTGTCCCAAGCGGGGGCACCGGGCCACCTAGA
GCCACGCGTGAGACTTCTCTAAGCAACCACCGAGCCCTTTGACCTTCTCCATTGTACCCC
CAAGATCTTTTTGCCCCATCTCCTAGAGAAACTGTGTTCTCCCTGCTCGGGGGCCCATGT
TTTTTTACACGCCTGCCTCCTGTCCCCTTATCCTTTCTCCCTCTGTAAATACGTTTTTCT
CTGTGGCTGTATGTGGGTTGCTTGGGGGTGGGATGGGAAGAGGCTCTTTGCAAACGAGGG
TCCCCAGAGAAGACTGGCGGGGACCTGATGGGGTAGCTGGGGTGTGGGGTTGGGGGATGA
GGTCAGGGGGTCTTGGGTGGGAGTTGGGGGCCCCTTCATTTCCCAGGTCTGGATCGATTC
ACTTGCCGGGAGAGACTTTTTACAACTCATCTGCAGCTCCGGGTGCGGTTGGGGGAGATA
GCGAAGGGTCTGGCCTCGCTGTGATCTGATTTGGGATTAAAGGTTTGGAAATTT
aacaactttgctttggagtctatttgtgatgtgatcgtgcattctggggtaaagaaaagt
gaccccatattccctccagaaacataccctccagaaacacttttaagcccagaagtcaca
tgaaaacgaacccatacacaatggttgagagtgtggaaaacacaatatattttttatttt