Gene CA11 Variant 1
DNA : 7.98 KbNT_011109
mRNA : 1455 bp NM_001217
CDS : 987 bp NP_001208
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  431 bp
gagactgaaacagggagaagaggcaggagaggaggaggtggggagagcacgaagctggag
gccgacactgagggagggcgggaggaggtgaagaaggagagaggggagaagaggcaggag
ctggaaaggagagagggaggaggaggaggagatgcgggatggagacctggagttaggtgg
CTTGGGAGAGCTTAATGAAAAGAGAACGGAGAGGAGGTGTGGGTTAGGAACCAAGAGGTA
GCCCTGGGGGCAGCAGAAGGCTGAGAGGAGTAGGAAGATCAGGAGCTAGAGGGAGACTGG
AGGGTTCCGGGAAAAGAGCAGAGGAAAGAGGAAAGACACAGAGAGACGGGAGAGAGAAGA
AGAGTGGGTTTGAAGGGCGGATCTCAGTCCCTGGCTGCTTTGGCATTTGGGGAACTGGGA
CTCCCTGTGGGGAGGAGAGGAAAGCTGGAAGTCCTGGAGGGACAGGGTCCCAGAAGGAGG
GGACAGAGGAGCTGAGAGAGGGGGGCAGGGCGTTGGGCAGGGGTCCCTCGGAGGCCTCCT
GGGGATGGGGGCTGCAGCTCGTCTGAGCGCCCCTCGAGCGCTGGTACTCTGGGCTGCACT
GGGGGCAGCAG
gtaagacctggggttcccgggaggagcccccgagggagggtggaggtggggatgccaagg
agagggattcaggctgctctcttcccagctcacatcggaccagcacctgaccccgaggac
tggtggagctacaaggataatctccagggaaacttcgtgccaggtgccgccaaggcgggg
EXON 2  75 bp
ggggtccctcggaggcctcctggggatgggggctgcagctcgtctgagcgcccctcgagc
gctggtactctgggctgcactgggggcagcaggtaagacctggggttcccgggaggagcc
cccgagggagggtggaggtggggatgccaaggagagggattcaggctgctctcttcccag
CTCACATCGGACCAGCACCTGACCCCGAGGACTGGTGGAGCTACAAGGATAATCTCCAGG
GAAACTTCGTGCCAG
gtgccgccaaggcggggacccaggagtccggccctcccggcgcctccttcttcagactca
ggaacctgggttcccagctccctcctcccccccaggaccaggagtcccagccccctcctc
tgtccctcaggagtcgggccagcttctgaaccccaggggctcaccatgggacattataca
EXON 3  143 bp
tctaggacccagaattctggatctgagcccagtcctccctcagacccaggagtctaggtc
cctagcccctcctcccctgggatctgggagtccagaccacagcccactcagcagatacca
gccctgggatccagtctctatttctgactccttgtcctcctactccgaccccacccccag
GGCCTCCTTTCTGGGGCCTGGTGAATGCAGCGTGGAGTCTGTGTGCTGTGGGGAAGCGGC
AGAGCCCCGTGGATGTGGAGCTGAAGAGGGTTCTTTATGACCCCTTTCTGCCCCCATTAA
GGCTCAGCACTGGAGGAGAGAAG
gtaaggggcttggagggaggagctattgaacccactggggatgggcatgaatagaggctg
gggaatggggtgctgaggtaggagagcagccttgggggaggaggggacacccagtgggtg
gagaggaggctgcttacactgtaaaatggatcacccattcttcccatcccaagcatggtc
EXON 4  186 bp
ggaggttgcggtgagccgagatcacgccactgcactccagcctgggcaacaagagcgaga
ctccgtttcaaaaaaaaaaaaaaaaaaaaaaaagactgttggaatcagaaaatgtaggcg
tgggaaacgagagataaaagatctctccctgccccctgacagctcccgcctctcccacag
CTCCGGGGAACCTTGTACAACACCGGCCGACATGTCTCCTTCCTGCCTGCACCCCGACCT
GTGGTCAATGTGTCTGGAGGTCCCCTCCTTTACAGCCACCGACTCAGTGAACTGCGGCTG
CTGTTTGGAGCTCGCGACGGAGCCGGCTCGGAACATCAGATCAACCACCAGGGCTTCTCT
GCTGAG
gtagtggccactgattgtttacccgccaccctccgccctgagtcaccccaattcctccca
cctcaccctcttagtgtctcaccccatcctcctccacagaactggcctcccaccctaagc
actaatcctcagcctgattcgggcccccaaagctggggtcatgctctcctccccttctgc
EXON 5  96 bp
tccgccctgagtcaccccaattcctcccacctcaccctcttagtgtctcaccccatcctc
ctccacagaactggcctcccaccctaagcactaatcctcagcctgattcgggcccccaaa
gctggggtcatgctctcctccccttctgctgggggaccccatgctctgtgctacccccag
GTGCAGCTCATTCACTTCAACCAGGAACTCTACGGGAATTTCAGCGCTGCCTCCCGCGGC
CCCAATGGCCTGGCCATTCTCAGCCTCTTTGTCAAC
gtgagcggaggcgagattcagagggagggagcagttgggtgcctggaacccggggtctga
gggaagcggggtgctgggaggcccagactcctgggtcctgggggaggagaaggttgaggg
cttggacttctgggctcctgtgtcctcacctcgtacccccacacaggttgccagtacctc
EXON 6  73 bp
gcctctttgtcaacgtgagcggaggcgagattcagagggagggagcagttgggtgcctgg
aacccggggtctgagggaagcggggtgctgggaggcccagactcctgggtcctgggggag
gagaaggttgagggcttggacttctgggctcctgtgtcctcacctcgtacccccacacag
GTTGCCAGTACCTCTAACCCATTCCTCAGTCGCCTCCTTAACCGCGACACCATCACTCGC
ATCTCCTACAAGA
gtaagtccctggcgtgctgggggcagtggtcacacacgagggggttcaagagtgccatcc
ctctttactctggcctgatattcccgcagatgatgcctactttcttcaagacctgagcct
ggagctcctgttccctgaatccttcggcttcatcacctatcagggctctctcagcacccc
EXON 7  155 bp
cctcgtacccccacacaggttgccagtacctctaacccattcctcagtcgcctccttaac
cgcgacaccatcactcgcatctcctacaagagtaagtccctggcgtgctgggggcagtgg
tcacacacgagggggttcaagagtgccatccctctttactctggcctgatattcccgcag
ATGATGCCTACTTTCTTCAAGACCTGAGCCTGGAGCTCCTGTTCCCTGAATCCTTCGGCT
TCATCACCTATCAGGGCTCTCTCAGCACCCCGCCCTGCTCCGAGACTGTCACCTGGATCC
TCATTGACCGGGCCCTCAATATCACCTCCCTTCAG
gtgaccctctgtccgcaccgcccttcctaggcctgggtactccactcactggcctgggca
tccccttgctcacctgccctccctctcctcatagactgaactcaagtaggtaagagggtc
agaccaccttgggggtgggtggggctgagaacagaccccgcccacctgctcccaggggcg
EXON 8  166 bp
acctgccctccctctcctcatagactgaactcaagtaggtaagagggtcagaccaccttg
ggggtgggtggggctgagaacagaccccgcccacctgctcccaggggcggggtttcctgc
gtgacgtcaccaagaccattcactattcactcccagtttcccaccctccttccactgcag
ATGCACTCCCTGAGACTCCTGAGCCAGAATCCTCCATCTCAGATCTTCCAGAGCCTCAGC
GGTAACAGCCGGCCCCTGCAGCCCTTGGCCCACAGGGCACTGAGGGGCAACAGGGACCCC
CGGCACCCCGAGAGGCGCTGCCGAGGCCCCAACTACCGCCTGCATG
gtatggtccagtctgcaccccctctaagtcttgggctaaccctcttatatgtgtctcccc
ttggtgtctcagtgtgattcagtcccatcctccttcctgcgtctatatggtctagcctcg
tgagctgtctctttttctctctttccctacatgtctatgtggtacagtccacctgccagc
EXON 9  130 bp
tcccccctcctattggcttcttgtggttcagcccagtgcttctcgacctagtacattctg
gttccccgctcgcagacttccgacggtagggcccagcgcggcgcagcccacgccccctgc
acaccccccgccccttccatcctatactgacgccccctgccgttgttctctgtcttacag
TGGATGGTGTCCCCCATGGTCGCTGAGACTCCCCTTCGAGGATTGCACCCGCCCGTCCTA
AGCCTCCCCACAAGGCGAGGGGAGTTACCCCTAAAACAAAGCTATTAAAGGGACAGAATA
CTTCCTGTTT
tctcagtggtctgattctaggcgcggtggggaaacatttgggtattaaagaacagacttc
ttccggaaaccaatcttcctctttctaaacctccgctctcggtattttggcttcctgctt
ctcaaaaccatctttaggaccgcggcccctttaagcggcgccccttttccccccatcacc