Gene BRD4 Variant 2
DNA : 31.93 KbNT_011295
mRNA : 3150 bp NM_014299
CDS : 2169 bp NP_055114
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  188 bp
ttactgcttgggaagcataaataacaacttggtgtcccttccccttgcccccacacctca
tgacttcagcacagtggtatgttttagatttcacctatgacacgggatatatctcattgt
aagcagatggccaggtgctgcagggagaggtcttggctctgatttgtttacgaggatgaa
ATTCTTTGGAATACTACTGCTAGAAGTCTGACTTAAGACCCAGCTTATGGGCCACATGGC
ACCCAGCTGCTTCTGCAGAGAAGGCAGGCCACTGATGGGTACAGCAAAGTGTGGTGCTGC
TGGCCAAGCCAAAGACCCGTGTAGGATGACTGGGCCTCTGCCCCTTGTGGGTGTTGCCAC
TGTGCTTG
gtgagtggagacagctgtggagcagaggacttgaagcacacactgttccaaatgacgtcc
agccaaccaggccaccatccactctgcctctgtccccatggggatgatgatgaagatgat
aaagtcgcagcctgctttttagggttgttgtgtggataactaagccaatacagatgaagt
EXON 2  319 bp
ttggggagaggagacattggaaccctttcagtcaaagcatggggtggtccctctggccaa
cttggctagctaccgccagggaactcagtccttggagaccacagccagagggacttgtca
ttctgagcggtgcccatctgctgactgatatctcacgggggctcttctcttcctttgtag
AGTGCCTGGTGAAGAATGTGATGGGATCACTAGCATGTCTGCGGAGAGCGGCCCTGGGAC
GAGATTGAGAAATCTGCCAGTAATGGGGGATGGACTAGAAACTTCCCAAATGTCTACAAC
ACAGGCCCAGGCCCAACCCCAGCCAGCCAACGCAGCCAGCACCAACCCCCCGCCCCCAGA
GACCTCCAACCCTAACAAGCCCAAGAGGCAGACCAACCAACTGCAATACCTGCTCAGAGT
GGTGCTCAAGACACTATGGAAACACCAGTTTGCATGGCCTTTCCAGCAGCCTGTGGATGC
CGTCAAGCTGAACCTCCCT
gtgagtagtgtgggcagggcccagggtggccgtcctggaggtcgtctcctgcatgtctcc
tggtcagggcagttcctggggggagggtaggagatgcatttggaatcatggtgagagctg
cagggcccttgagtgagtggtttcagcagttctgatcagttgaaatcagggagaaagaat
EXON 3  138 bp
ctccactttattttggtgttccccctcaagatcacttgctgatgccagtaggagctgtgg
ctcccgtggatttacctgtggagcagccaggggtgaggtccccaggccagcctggccagc
ccagcgtttgtgctgcctggctgcctaggtgacactggacttttgctctctgctctccag
GATTACTATAAGATCATTAAAACGCCTATGGATATGGGAACAATAAAGAAGCGCTTGGAA
AACAACTATTACTGGAATGCTCAGGAATGTATCCAGGACTTCAACACTATGTTTACAAAT
TGTTACATCTACAACAAG
gtgagatgtaggggtgggtgtccagctgccctggggagagaggaggggaggcgacggcag
tgggcatgtcaggagcccgtgggcaggggtgttgggtgtggctgggcttggagtctggca
agaggagacccttggaggtagaggtaatgagacctgtggttgttcctgtgactgggtgtg
EXON 4  136 bp
caagcctctgtgatacctggtagtgtagccattgtggctcctttgggtgcagatcgggga
aggacccggaatacgacgcttcatgttttgggggcagggggtgggtggcatggggtgccc
tgtctacagaggtggggaggggagggccctctgactctacccctgtgtctccttatccag
CCTGGAGATGACATAGTCTTAATGGCAGAAGCTCTGGAAAAGCTCTTCTTGCAAAAAATA
AATGAGCTACCCACAGAAGAAACCGAGATCATGATAGTCCAGGCAAAAGGAAGAGGACGT
GGGAGGAAAGAAACAG
gtagagtactgaaatagcaagtaaattggctttctccccgacctttgtcccttttccaag
tttggtggggggctgggagtggcaggaggatgtgacattatatactgcatgccgtgttgg
tgtttggacatgtgagattgggtttggtgttggatccatcccatagggtcatgtggccct
EXON 5  290 bp
ttctttgagccccagggacaggtggaagggtttggcagagtggagtctgggatgttcgtc
tctcaggcaaatgcaacacgcgaatgtgcgttcactgtgtgtggtgtatgtccccacgag
gtcagccagcatgtggatgtcagcatggtctctaactcgccgtcttattatgatttgtag
GGACAGCAAAACCTGGCGTTTCCACGGTACCAAACACAACTCAAGCATCGACTCCTCCGC
AGACCCAGACCCCTCAGCCGAATCCTCCTCCTGTGCAGGCCACGCCTCACCCCTTCCCTG
CCGTCACCCCGGACCTCATCGTCCAGACCCCTGTCATGACAGTGGTGCCTCCCCAGCCAC
TGCAGACGCCCCCGCCAGTGCCCCCCCAGCCACAACCCCCACCCGCTCCAGCTCCCCAGC
CCGTACAGAGCCACCCACCCATCATCGCGGCCACCCCACAGCCTGTGAAG
gtgagtctcctggactctggagggctgcttcaccagggaggagagcggccctgtccttgc
ccgtgctttacacagagcctgtcctgggtcccgggcactggtgggtgtttctggggagat
cttgctgtgttgaaattgcagcccagaaacagccgccccactgactcaaaggtcccataa
EXON 6  363 bp
gagcagagtggtgggacacgatctgcctgtccttggccctttgcctgtgcaattatcttt
gggtccattctgtgtgagcgatgggccccaagacagggcctggctttgggggtgaccctg
agggcagctgtgccggctgccacttctgactgtgcctgttggcgtccgtgttcttggcag
ACAAAGAAGGGAGTGAAGAGGAAAGCAGACACCACCACCCCCACCACCATTGACCCCATT
CACGAGCCACCCTCGCTGCCCCCGGAGCCCAAGACCACCAAGCTGGGCCAGCGGCGGGAG
AGCAGCCGGCCTGTGAAACCTCCAAAGAAGGACGTGCCCGACTCTCAGCAGCACCCAGCA
CCAGAGAAGAGCAGCAAGGTCTCGGAGCAGCTCAAGTGCTGCAGCGGCATCCTCAAGGAG
ATGTTTGCCAAGAAGCACGCCGCCTACGCCTGGCCCTTCTACAAGCCTGTGGACGTGGAG
GCACTGGGCCTACACGACTACTGTGACATCATCAAGCACCCCATGGACATGAGCACAATC
AAG
gttagcgggatgtgcctgagggaagggacaaggtgggcaggctgtccctccacatcagaa
ccttcctagaccttttagtccaagaggaagcccaggccctggaacggtggctgcgtggat
ttttcccgccaactcgaagaaactcagcgccccctgctgtctgctgtgggacgtgctctg
EXON 7  129 bp
ccagtcccagccctgaggctgagaactggggtgatggcctgtccccccactagagtcttg
accaaactgagagccaagaaaccaacttgctcttctaggcatccctttcgtctgctgcca
gccacttctccatggtcacatgggcagacacagctaacagggacttgtcttgttttccag
TCTAAACTGGAGGCCCGTGAGTACCGTGATGCTCAGGAGTTTGGTGCTGACGTCCGATTG
ATGTTCTCCAACTGCTATAAGTACAACCCTCCTGACCATGAGGTGGTGGCCATGGCCCGC
AAGCTCCAG
gtgaggcttgggagggcgcagccaccctcagcagagcaggctgaggtcctcgtgggagca
gacttctgtgggccttggcagagtttttttttctgtcactttccttgggataatgccatg
ttgctttagaaaagtgcctaaagtcagcctagtgcatacattttaagttggggttattca
EXON 8  210 bp
ttgtcagaggcccttggctggcccttgcccctgtctcggcagcaaagagacaggatcacc
atcctctttcgccctcggttgctttctgttgagttggccccagcagccaatgagggcagg
tgatgctaggccgcggcctgggtacccagcagccgtcacagcatgtctttccctcaccag
GATGTGTTCGAAATGCGCTTTGCCAAGATGCCGGACGAGCCTGAGGAGCCAGTGGTGGCC
GTGTCCTCCCCGGCAGTGCCCCCTCCCACCAAGGTTGTGGCCCCGCCCTCATCCAGCGAC
AGCAGCAGCGATAGCTCCTCGGACAGTGACAGTTCGACTGATGACTCTGAGGAGGAGCGA
GCCCAGCGGCTGGCTGAGCTCCAGGAGCAG
gtgagggcattggtggctccattcttaatccccagagtccgtggaccagggtggcctccc
cagaagtttctaagagatgttcttggttctgagttcccaagggagcataattcccactgg
accacctgtggccttttcccctttgctaggtcaaatgcatgttgatcatacacgtatgta
EXON 9  200 bp
aatctggttaacatgacaggcgcaaagctgggggccttcccttcccctgcctcccctatg
cccacaccctgatgccccaggtgcatgctgtcgcatgttttttggagcagacgcctgggt
cttgggtgacaggaaggtggtttcagccctgagtgtgtgtcttgcctgtctggtctacag
CTCAAAGCCGTGCACGAGCAGCTTGCAGCCCTCTCTCAGCCCCAGCAGAACAAACCAAAG
AAAAAGGAGAAAGACAAGAAGGAAAAGAAAAAAGAAAAGCACAAAAGGAAAGAGGAAGTG
GAAGAGAATAAAAAAAGCAAAGCCAAGGAACCTCCTCCTAAAAAGACGAAGAAAAATAAT
AGCAGCAACAGCAATGTGAG
gtctgtgtcccctgaatttgtcctgggtggggaccctccttccagggcttgctctgagac
tgtgtgggccactgcccctccctgtcctcattgggtgcggaggctgcccctctgcagccg
tggcttcacaggccaggctggtggccacttgcacacaggacttagctgcactgtctctgc
EXON 10  296 bp
gcttcggtctccactgggtgctcccagagattgagttgcccatgccccgtttcctgtgaa
ggctggtgggtggggggtatgggaagggcaccccttccccccaacatacatgtggaggaa
tgagtgcctggcttcctcagggggcccgttcttgatggtgtctgcatcgtcccttcgtag
CAAGAAGGAGCCAGCGCCCATGAAGAGCAAGCCCCCTCCCACGTATGAGTCGGAGGAAGA
GGACAAGTGCAAGCCTATGTCCTATGAGGAGAAGCGGCAGCTCAGCTTGGACATCAACAA
GCTCCCCGGCGAGAAGCTGGGCCGCGTGGTGCACATCATCCAGTCACGGGAGCCCTCCCT
GAAGAATTCCAACCCCGACGAGATTGAAATCGACTTTGAGACCCTGAAGCCGTCCACACT
GCGTGAGCTGGAGCGCTATGTCACCTCCTGTTTGCGGAAGAAAAGGAAACCTCAAG
gtgtgcttgggccccctgggcatggggttccttctgtgggcaccctcagagtaacttttc
cctccttgctcagtccactctttctgcgcccccccccttttttttttccaattataatat
ctgtgttcttgacacagaaacctccgaaaggttgtgacattgcactcacccctaggctgt
EXON 11  111 bp
ggaactgtgggaccacgtgggttctgggagtggcagctggcagttgggagcagcccctgg
gcccaccgtgcacaggctcctcactggtccttcctccagatggatggggtgtgcccatgg
cttagagcggcttcctgggccacagccctgcctgaccagctcccattgcttggattgcag
CTGAGAAAGTTGATGTGATTGCCGGCTCCTCCAAGATGAAGGGCTTCTCGTCCTCAGAGT
CGGAGAGCTCCAGTGAGTCCAGCTCCTCTGACAGCGAAGACTCCGAAACAG
gttaggtgacttgtgttctacgtgtcttaccaaactcttcccacctgtgcctggcactag
ctcggtcctgtgtccaggatgctagagcccagagacggcactcccagaacttgctgggtt
cctctgtctgtctgtctctttgttaactgtctccctggggccatgaatagccctgcactc
EXON 12  770 bp
tgtccctacccagggttagccaggcacggggcagggctccagtctccagtgccgttcttg
tgcccatcagccaccagggcgcaggaggttggctcagtctgcggttcttctgttcttgtg
acttaaatggtacattccacaccatttctctcacactggtttctctctccctctacgtag
GTCCTGCCTAATCATTGGACACGGACTCTTAATAAAACGGTCTTCAGTTCCAGATTCCTT
CCCAGCAAGCTATAGCTTAAGTCCATTTTCTTCCGTGAAAGGGACAGGACTCCATCAAGT
TATGGAATTCCTCAGAGCCCTGGGCCTGTCCCCCGGGGTGGATTAGTCATGTCCAGCAGC
ACACGCCTAGTCCCGCCTTCGGGAAGGCTGCCTGCCTGGCCAGCCGCCCAGGCCTCTCTG
TGTAAAGACTGCCTGGCTGTCCTGCCCAGCCTTCCTGGTTCTCTGGGGTCCTCTGGGTGG
GTGGCATCTCCTGGAGGGTGATGACAATCCCCAACACATGCATTCATGTGGTGCTACTCT
GTGTGCAAAGCCAGACCCCAAGTATGTTTTCTCTCTTTGTCCCATCCCTCTTTTTCTGGG
ACTTTGGACCCTAACTACTTCCCTCCTGAACCTTGCAGTGACATCAGTCCAGGAGAGCTC
TCGTTCAGTGTGCGGAAGAACACTCTGACCTCTAGAGCTGTCCTAGATAAGGAGTGGGAG
CTTTAGAGGCAAGGCCTCTAGACCCTGGAAGGCTCAGTGAGGCTCTTCCCACAGCATGCT
TCTCACTGGTGCCCTGTAAGGCTCGAGCCACCGCTGACTCTGAGCCTTTTGGAGTCTTTC
CTCCTTCGTCTCCATTGTTCCCGTGCATTTCCAAAAGCTTAAGTTGCCTGGTGGGCATTT
CCCCAGTTTCTTTGGCCTCCGTCTTCTCAAGTCACATAGGGAAAGTACCT
cctggaaccaggctgcagtatgcaggacctgccaggcaggcactggtgaagggccttggg
cctatcatccccccaaccccacctcaccccacccgcctcctctagtggggtgagtctggg
ctggtggaccagagagggtgtcacagaccctcagggactgccccatggacacctctgact