Gene BRD4 Variant 1
DNA : 42.96 KbNT_011295
mRNA : 5198 bp NM_058243
CDS : 4089 bp NP_490597
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  188 bp
ttactgcttgggaagcataaataacaacttggtgtcccttccccttgcccccacacctca
tgacttcagcacagtggtatgttttagatttcacctatgacacgggatatatctcattgt
aagcagatggccaggtgctgcagggagaggtcttggctctgatttgtttacgaggatgaa
ATTCTTTGGAATACTACTGCTAGAAGTCTGACTTAAGACCCAGCTTATGGGCCACATGGC
ACCCAGCTGCTTCTGCAGAGAAGGCAGGCCACTGATGGGTACAGCAAAGTGTGGTGCTGC
TGGCCAAGCCAAAGACCCGTGTAGGATGACTGGGCCTCTGCCCCTTGTGGGTGTTGCCAC
TGTGCTTG
gtgagtggagacagctgtggagcagaggacttgaagcacacactgttccaaatgacgtcc
agccaaccaggccaccatccactctgcctctgtccccatggggatgatgatgaagatgat
aaagtcgcagcctgctttttagggttgttgtgtggataactaagccaatacagatgaagt
EXON 2  319 bp
ttggggagaggagacattggaaccctttcagtcaaagcatggggtggtccctctggccaa
cttggctagctaccgccagggaactcagtccttggagaccacagccagagggacttgtca
ttctgagcggtgcccatctgctgactgatatctcacgggggctcttctcttcctttgtag
AGTGCCTGGTGAAGAATGTGATGGGATCACTAGCATGTCTGCGGAGAGCGGCCCTGGGAC
GAGATTGAGAAATCTGCCAGTAATGGGGGATGGACTAGAAACTTCCCAAATGTCTACAAC
ACAGGCCCAGGCCCAACCCCAGCCAGCCAACGCAGCCAGCACCAACCCCCCGCCCCCAGA
GACCTCCAACCCTAACAAGCCCAAGAGGCAGACCAACCAACTGCAATACCTGCTCAGAGT
GGTGCTCAAGACACTATGGAAACACCAGTTTGCATGGCCTTTCCAGCAGCCTGTGGATGC
CGTCAAGCTGAACCTCCCT
gtgagtagtgtgggcagggcccagggtggccgtcctggaggtcgtctcctgcatgtctcc
tggtcagggcagttcctggggggagggtaggagatgcatttggaatcatggtgagagctg
cagggcccttgagtgagtggtttcagcagttctgatcagttgaaatcagggagaaagaat
EXON 3  138 bp
ctccactttattttggtgttccccctcaagatcacttgctgatgccagtaggagctgtgg
ctcccgtggatttacctgtggagcagccaggggtgaggtccccaggccagcctggccagc
ccagcgtttgtgctgcctggctgcctaggtgacactggacttttgctctctgctctccag
GATTACTATAAGATCATTAAAACGCCTATGGATATGGGAACAATAAAGAAGCGCTTGGAA
AACAACTATTACTGGAATGCTCAGGAATGTATCCAGGACTTCAACACTATGTTTACAAAT
TGTTACATCTACAACAAG
gtgagatgtaggggtgggtgtccagctgccctggggagagaggaggggaggcgacggcag
tgggcatgtcaggagcccgtgggcaggggtgttgggtgtggctgggcttggagtctggca
agaggagacccttggaggtagaggtaatgagacctgtggttgttcctgtgactgggtgtg
EXON 4  136 bp
caagcctctgtgatacctggtagtgtagccattgtggctcctttgggtgcagatcgggga
aggacccggaatacgacgcttcatgttttgggggcagggggtgggtggcatggggtgccc
tgtctacagaggtggggaggggagggccctctgactctacccctgtgtctccttatccag
CCTGGAGATGACATAGTCTTAATGGCAGAAGCTCTGGAAAAGCTCTTCTTGCAAAAAATA
AATGAGCTACCCACAGAAGAAACCGAGATCATGATAGTCCAGGCAAAAGGAAGAGGACGT
GGGAGGAAAGAAACAG
gtagagtactgaaatagcaagtaaattggctttctccccgacctttgtcccttttccaag
tttggtggggggctgggagtggcaggaggatgtgacattatatactgcatgccgtgttgg
tgtttggacatgtgagattgggtttggtgttggatccatcccatagggtcatgtggccct
EXON 5  290 bp
ttctttgagccccagggacaggtggaagggtttggcagagtggagtctgggatgttcgtc
tctcaggcaaatgcaacacgcgaatgtgcgttcactgtgtgtggtgtatgtccccacgag
gtcagccagcatgtggatgtcagcatggtctctaactcgccgtcttattatgatttgtag
GGACAGCAAAACCTGGCGTTTCCACGGTACCAAACACAACTCAAGCATCGACTCCTCCGC
AGACCCAGACCCCTCAGCCGAATCCTCCTCCTGTGCAGGCCACGCCTCACCCCTTCCCTG
CCGTCACCCCGGACCTCATCGTCCAGACCCCTGTCATGACAGTGGTGCCTCCCCAGCCAC
TGCAGACGCCCCCGCCAGTGCCCCCCCAGCCACAACCCCCACCCGCTCCAGCTCCCCAGC
CCGTACAGAGCCACCCACCCATCATCGCGGCCACCCCACAGCCTGTGAAG
gtgagtctcctggactctggagggctgcttcaccagggaggagagcggccctgtccttgc
ccgtgctttacacagagcctgtcctgggtcccgggcactggtgggtgtttctggggagat
cttgctgtgttgaaattgcagcccagaaacagccgccccactgactcaaaggtcccataa
EXON 6  363 bp
gagcagagtggtgggacacgatctgcctgtccttggccctttgcctgtgcaattatcttt
gggtccattctgtgtgagcgatgggccccaagacagggcctggctttgggggtgaccctg
agggcagctgtgccggctgccacttctgactgtgcctgttggcgtccgtgttcttggcag
ACAAAGAAGGGAGTGAAGAGGAAAGCAGACACCACCACCCCCACCACCATTGACCCCATT
CACGAGCCACCCTCGCTGCCCCCGGAGCCCAAGACCACCAAGCTGGGCCAGCGGCGGGAG
AGCAGCCGGCCTGTGAAACCTCCAAAGAAGGACGTGCCCGACTCTCAGCAGCACCCAGCA
CCAGAGAAGAGCAGCAAGGTCTCGGAGCAGCTCAAGTGCTGCAGCGGCATCCTCAAGGAG
ATGTTTGCCAAGAAGCACGCCGCCTACGCCTGGCCCTTCTACAAGCCTGTGGACGTGGAG
GCACTGGGCCTACACGACTACTGTGACATCATCAAGCACCCCATGGACATGAGCACAATC
AAG
gttagcgggatgtgcctgagggaagggacaaggtgggcaggctgtccctccacatcagaa
ccttcctagaccttttagtccaagaggaagcccaggccctggaacggtggctgcgtggat
ttttcccgccaactcgaagaaactcagcgccccctgctgtctgctgtgggacgtgctctg
EXON 7  129 bp
ccagtcccagccctgaggctgagaactggggtgatggcctgtccccccactagagtcttg
accaaactgagagccaagaaaccaacttgctcttctaggcatccctttcgtctgctgcca
gccacttctccatggtcacatgggcagacacagctaacagggacttgtcttgttttccag
TCTAAACTGGAGGCCCGTGAGTACCGTGATGCTCAGGAGTTTGGTGCTGACGTCCGATTG
ATGTTCTCCAACTGCTATAAGTACAACCCTCCTGACCATGAGGTGGTGGCCATGGCCCGC
AAGCTCCAG
gtgaggcttgggagggcgcagccaccctcagcagagcaggctgaggtcctcgtgggagca
gacttctgtgggccttggcagagtttttttttctgtcactttccttgggataatgccatg
ttgctttagaaaagtgcctaaagtcagcctagtgcatacattttaagttggggttattca
EXON 8  210 bp
ttgtcagaggcccttggctggcccttgcccctgtctcggcagcaaagagacaggatcacc
atcctctttcgccctcggttgctttctgttgagttggccccagcagccaatgagggcagg
tgatgctaggccgcggcctgggtacccagcagccgtcacagcatgtctttccctcaccag
GATGTGTTCGAAATGCGCTTTGCCAAGATGCCGGACGAGCCTGAGGAGCCAGTGGTGGCC
GTGTCCTCCCCGGCAGTGCCCCCTCCCACCAAGGTTGTGGCCCCGCCCTCATCCAGCGAC
AGCAGCAGCGATAGCTCCTCGGACAGTGACAGTTCGACTGATGACTCTGAGGAGGAGCGA
GCCCAGCGGCTGGCTGAGCTCCAGGAGCAG
gtgagggcattggtggctccattcttaatccccagagtccgtggaccagggtggcctccc
cagaagtttctaagagatgttcttggttctgagttcccaagggagcataattcccactgg
accacctgtggccttttcccctttgctaggtcaaatgcatgttgatcatacacgtatgta
EXON 9  200 bp
aatctggttaacatgacaggcgcaaagctgggggccttcccttcccctgcctcccctatg
cccacaccctgatgccccaggtgcatgctgtcgcatgttttttggagcagacgcctgggt
cttgggtgacaggaaggtggtttcagccctgagtgtgtgtcttgcctgtctggtctacag
CTCAAAGCCGTGCACGAGCAGCTTGCAGCCCTCTCTCAGCCCCAGCAGAACAAACCAAAG
AAAAAGGAGAAAGACAAGAAGGAAAAGAAAAAAGAAAAGCACAAAAGGAAAGAGGAAGTG
GAAGAGAATAAAAAAAGCAAAGCCAAGGAACCTCCTCCTAAAAAGACGAAGAAAAATAAT
AGCAGCAACAGCAATGTGAG
gtctgtgtcccctgaatttgtcctgggtggggaccctccttccagggcttgctctgagac
tgtgtgggccactgcccctccctgtcctcattgggtgcggaggctgcccctctgcagccg
tggcttcacaggccaggctggtggccacttgcacacaggacttagctgcactgtctctgc
EXON 10  296 bp
gcttcggtctccactgggtgctcccagagattgagttgcccatgccccgtttcctgtgaa
ggctggtgggtggggggtatgggaagggcaccccttccccccaacatacatgtggaggaa
tgagtgcctggcttcctcagggggcccgttcttgatggtgtctgcatcgtcccttcgtag
CAAGAAGGAGCCAGCGCCCATGAAGAGCAAGCCCCCTCCCACGTATGAGTCGGAGGAAGA
GGACAAGTGCAAGCCTATGTCCTATGAGGAGAAGCGGCAGCTCAGCTTGGACATCAACAA
GCTCCCCGGCGAGAAGCTGGGCCGCGTGGTGCACATCATCCAGTCACGGGAGCCCTCCCT
GAAGAATTCCAACCCCGACGAGATTGAAATCGACTTTGAGACCCTGAAGCCGTCCACACT
GCGTGAGCTGGAGCGCTATGTCACCTCCTGTTTGCGGAAGAAAAGGAAACCTCAAG
gtgtgcttgggccccctgggcatggggttccttctgtgggcaccctcagagtaacttttc
cctccttgctcagtccactctttctgcgcccccccccttttttttttccaattataatat
ctgtgttcttgacacagaaacctccgaaaggttgtgacattgcactcacccctaggctgt
EXON 11  111 bp
ggaactgtgggaccacgtgggttctgggagtggcagctggcagttgggagcagcccctgg
gcccaccgtgcacaggctcctcactggtccttcctccagatggatggggtgtgcccatgg
cttagagcggcttcctgggccacagccctgcctgaccagctcccattgcttggattgcag
CTGAGAAAGTTGATGTGATTGCCGGCTCCTCCAAGATGAAGGGCTTCTCGTCCTCAGAGT
CGGAGAGCTCCAGTGAGTCCAGCTCCTCTGACAGCGAAGACTCCGAAACAG
gttaggtgacttgtgttctacgtgtcttaccaaactcttcccacctgtgcctggcactag
ctcggtcctgtgtccaggatgctagagcccagagacggcactcccagaacttgctgggtt
cctctgtctgtctgtctctttgttaactgtctccctggggccatgaatagccctgcactc
EXON 12  53 bp
cctcgcatgtctctccctctcccgtgatgaccaactcatccctcattgaactcggctgcc
ctttctcagggtcactggtccttctcctgaaagtgccctgttttctcgtctttcttcatc
caaggccagctcactcaccttctcccccagagcctcactaccttctcttttcctctgcag
AGATGGCTCCGAAGTCAAAAAAGAAGGGGCACCCCGGGAGGGAGCAGAAGAAG
gtacatgggctcaggggcatccttcattaggtgggacgttgggtctggcccgggccagtt
ctgcctgcctgacatcagcctgtctgtctgtctgtctctctgtctgcagcaccatcatca
ccaccatcagcagatgcagcaggccccggctcctgtgccccagcagccgcccccgcctcc
EXON 13  370 bp
ttctcttttcctctgcagagatggctccgaagtcaaaaaagaaggggcaccccgggaggg
agcagaagaaggtacatgggctcaggggcatccttcattaggtgggacgttgggtctggc
ccgggccagttctgcctgcctgacatcagcctgtctgtctgtctgtctctctgtctgcag
CACCATCATCACCACCATCAGCAGATGCAGCAGGCCCCGGCTCCTGTGCCCCAGCAGCCG
CCCCCGCCTCCCCAGCAGCCCCCACCGCCTCCACCTCCGCAGCAGCAACAGCAGCCGCCA
CCCCCGCCTCCCCCACCCTCCATGCCGCAGCAGGCAGCCCCGGCGATGAAGTCCTCGCCC
CCACCCTTCATTGCCACCCAGGTGCCCGTCCTGGAGCCCCAGCTCCCAGGCAGCGTCTTT
GACCCCATCGGCCACTTCACCCAGCCCATCCTGCACCTGCCGCAGCCTGAGCTGCCCCCT
CACCTGCCCCAGCCGCCTGAGCACAGCACTCCACCCCATCTCAACCAGCACGCAGTGGTC
TCTCCTCCAG
gtgagccgtggcctgccccagtgtgggttgagaccccttcctgcctcggtttacccatgt
ggtgtccgagcactctggctgggcagcttcttagcctcagctgctctggtctctagaggg
aagatctgtggcttctcgaggccatcttggaagttaaaggagatgcctcaagacaggtca
EXON 14  588 bp
ctggaagctgtttactgctctggagtttgtgggaggccacggtaggtggggagggagtgc
cagtttgagggaggccagtaggagagcactggagtccagatgaggtcaggatggagcaga
aaggccaggctggggccacaggtgctcaggcctcaccgcctcggtgttgtgttcttccag
CTTTGCACAACGCACTACCCCAGCAGCCATCACGGCCCAGCAACCGAGCCGCTGCCCTGC
CTCCCAAGCCCGCCCGGCCCCCAGCCGTGTCACCAGCCTTGACCCAAACACCCCTGCTCC
CACAGCCCCCCATGGCCCAACCCCCCCAAGTGCTGCTGGAGGATGAAGAGCCACCTGCCC
CACCCCTCACCTCCATGCAGATGCAGCTGTACCTGCAGCAGCTGCAGAAGGTGCAGCCCC
CTACGCCGCTACTCCCTTCCGTGAAGGTGCAGTCCCAGCCCCCACCCCCCCTGCCGCCCC
CACCCCACCCCTCTGTGCAGCAGCAGCTGCAGCAGCAGCCGCCACCACCCCCACCACCCC
AGCCCCAGCCTCCACCCCAGCAGCAGCATCAGCCCCCTCCACGGCCCGTGCACTTGCAGC
CCATGCAGTTTTCCACCCACATCCAACAGCCCCCGCCACCCCAGGGCCAGCAGCCCCCCC
ATCCGCCCCCAGGCCAGCAGCCACCCCCGCCGCAGCCTGCCAAGCCTCAGCAAGTCATCC
AGCACCACCATTCACCCCGGCACCACAAGTCGGACCCCTACTCAACCG
gtaagtggtcctcacccgtagactctggggaggctggtgctgggcctatagttttgtcct
caggaagccagaagggttaactcatgcttcaggctgcagtgggttcagagctgagcctca
gcttggagggggacctggaagggtcattggtgcttcctacagtgtgtgtttatcaggtgt
EXON 15  113 bp
caggcccagtcacttgtgtgggtcttcaccctttttgagctgggctaatggacccttgtc
ccagggcctgggcggcacatgcagtttctccatacagcccacgttttccttcccgacaat
tctctcagggccagcagttctaagccagccccttgacacattccttgtcccttctcctag
GTCACCTCCGCGAAGCCCCCTCCCCGCTTATGATACATTCCCCCCAGATGTCACAGTTCC
AGAGCCTGACCCACCAGTCTCCACCCCAGCAAAACGTCCAGCCTAAGAAACAG
gtaactggcagggctgggccatagtcctgtgggctagggccgggggtgcctgcccacctc
accggccgctgtgcctgtgccatcccaggagctgcgtgctgcctccgtggtccagcccca
gcccctcgtggtggtgaaggaggagaagatccactcacccatcatccgcagcgagccctt
EXON 16  163 bp
ccccgcttatgatacattccccccagatgtcacagttccagagcctgacccaccagtctc
caccccagcaaaacgtccagcctaagaaacaggtaactggcagggctgggccatagtcct
gtgggctagggccgggggtgcctgcccacctcaccggccgctgtgcctgtgccatcccag
GAGCTGCGTGCTGCCTCCGTGGTCCAGCCCCAGCCCCTCGTGGTGGTGAAGGAGGAGAAG
ATCCACTCACCCATCATCCGCAGCGAGCCCTTCAGCCCCTCGCTGCGGCCGGAGCCCCCC
AAGCACCCGGAGAGCATCAAGGCCCCCGTCCACCTGCCCCAGC
gtgagtgctctccctgcccacagccagggctcaggccccccgaggcccgtgttggacata
agcttgctgtggggctggtggaccatgccccactggggtgaggtgggccagggcccaccg
gctgtttatgttccagggccggaaatgaagcctgtggatgtcgggaggcctgtgatccgg
EXON 17  131 bp
caagcacccggagagcatcaaggcccccgtccacctgccccagcgtgagtgctctccctg
cccacagccagggctcaggccccccgaggcccgtgttggacataagcttgctgtggggct
ggtggaccatgccccactggggtgaggtgggccagggcccaccggctgtttatgttccag
GGCCGGAAATGAAGCCTGTGGATGTCGGGAGGCCTGTGATCCGGCCCCCAGAGCAGAACG
CACCGCCACCAGGGGCCCCTGACAAGGACAAACAGAAACAGGAGCCGAAGACTCCAGTTG
CGCCCAAAAAG
gttgggatggaggtccatgggtgtcgcttgccccttggccctggaaggtgccatgctggg
cacacccccagctatgccctttaggcacagcagacccctcacccaccccaacctctctgt
tctgcaggacctgaaaatcaagaacatgggctcctgggccagcctagtgcagaagcatcc
EXON 18  206 bp
ctgacaaggacaaacagaaacaggagccgaagactccagttgcgcccaaaaaggttggga
tggaggtccatgggtgtcgcttgccccttggccctggaaggtgccatgctgggcacaccc
ccagctatgccctttaggcacagcagacccctcacccaccccaacctctctgttctgcag
GACCTGAAAATCAAGAACATGGGCTCCTGGGCCAGCCTAGTGCAGAAGCATCCGACCACC
CCCTCCTCCACAGCCAAGTCATCCAGCGACAGCTTCGAGCAGTTCCGCCGCGCCGCTCGG
GAGAAAGAGGAGCGTGAGAAGGCCCTGAAGGCTCAGGCCGAGCACGCTGAGAAGGAGAAG
GAGCGGCTGCGGCAGGAGCGCATGAG
gtgggcgggtgtctgggtggggcatggggactcttggggccacaccagtccccaggctga
ctgggaccctctgcccaggagccgagaggacgaggatgcgctggagcaggcccggcgggc
ccatgaggaggcacgtcggcgccaggagcagcagcagcagcagcgccaggagcaacagca
EXON 19  238 bp
ccgccgcgccgctcgggagaaagaggagcgtgagaaggccctgaaggctcaggccgagca
cgctgagaaggagaaggagcggctgcggcaggagcgcatgaggtgggcgggtgtctgggt
ggggcatggggactcttggggccacaccagtccccaggctgactgggaccctctgcccag
GAGCCGAGAGGACGAGGATGCGCTGGAGCAGGCCCGGCGGGCCCATGAGGAGGCACGTCG
GCGCCAGGAGCAGCAGCAGCAGCAGCGCCAGGAGCAACAGCAGCAGCAGCAACAGCAAGC
AGCTGCGGTGGCTGCCGCCGCCACCCCACAGGCCCAGAGCTCCCAGCCCCAGTCCATGCT
GGACCAGCAGAGGGAGTTGGCCCGGAAGCGGGAGCAGGAGCGAAGACGCCGGGAAGCC
gtgagtctggaggcctggtggggaccctggtctaaggattagctcctgagggagctggga
aagggggactggagcctggacagggaggggcagcgggggagccccgtccctgctggtcgg
catgtggtcctctggactcagctgtagggccctgagtgctgtgtggacggggtgagcgct
EXON 20  956 bp
cggcatgtggtcctctggactcagctgtagggccctgagtgctgtgtggacggggtgagc
gctatgaggggtcagccacggggagggctacggggctgactgctggtagcgggtatgagg
gcttgtagctgcagggtggctaggtcatcctcctgactccctccttcctttctcctccag
ATGGCAGCTACCATTGACATGAATTTCCAGAGTGATCTATTGTCAATATTTGAAGAAAAT
CTTTTCTGAGCGCACCTAGGTGGCTTCTGACTTTGATTTTCTGGCAAAACATTGACTTTC
CATAGTGTTAGGGGCGGTGGTGGAGGTGGGATCAGCGGCCAGGGGATGCCTCAGGGCCTG
GCCCTCCTGCATGCTATGCCCGGGGCAGGCCTGACGGGCAGCTGAGGATTGCAGAGCCTG
TCTGCCTTACGGCCAGTCGGACAGACGTCCCGCCACCCACCACCCCTCACAGGACGTCCG
CTCAGCACACGCCTTGTTACGAGCAAGTGCCGGCTGGACCCAAGCCCTGCATCCCCACAT
GCGGGGCAGAGGCCCTTCTCTCCGCCAAATGTCTACACAGTATACACAGGACATCGTTGC
TGCCGCCGTGACTGGTTTTCTGTCCCCAAGAACGTGACGTTCGTGATGTCCTGCCCGCCG
GGAGTCTTTCCCCACACCCCAGCCATCGCCGCCCGCTCCCAGGAGGCCAGGGCAGGCCTG
CGTGGGCTGGAGGCGGGCGAGGCCGGCCCACCCCCTCGCTGGCACTGACTTTGCCTTGAA
CAGACCCCCCGACCCTCCCCCACAAGCCTTTAATTGAGAGCCGCTCTCTGTAAGTGTTTG
CTTGTGCAAAAGGGAATAGTGCCGTGGAGGTGTGTGTGTCCATGGCATCCGGAGCGAGGC
GACTGTCCTGCGTGGGTAGCCCTCGGCCGGGGAGTGAGGCCACCAACCAAAGTCAGTTCC
TTCCCACCTGTGTTTCTGTTTCGTTTTTTTTTTTCTTTTTTTTCTATATATATTTTTTGT
TGAATTCTATTTTATTTTTAATTCTCTCTTCTCCTCCAGACACAATGGCACTGCTTATCT
CCGAAATGGTGTGATCGTCTCCTCATTGAGCAGCGGCTGCCACCGCGCTGTGGGTA
gtgtgtgaccgtggctgtactgtatagtgaacatagttggcatatctttgtttgaagttt
gttggtgactccaccaaactggtgtgaaaaaagaaaaaagctcaaaaaaatccacaaaaa
gacaaaacacacaaaaaaaatcctgcctatattttactcagtttcaaactttattagtct