Gene BCAT2 Variant 1
DNA : 15.94 KbNT_011109
mRNA : 1541 bp NM_001190
CDS : 1179 bp NP_001181
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  24 bp
ctcccaccagcgcctgcgccccgcagcagtgtccggctccctgccgacgccctggagctg
ggacggcctggggcgctggtcggccgccttcccccagaaggaggcgtgagcggggcgtgg
ccggaacgtctctcttcggagccgcgccccgggcgggcacagttacgcgccgcacggatc
ATGGCCGCAGCCGCTCTGGGGCAG
gtgggttcgcagccccgcgccggggtctgggaaataaccgggggaggcgcacttccggga
agaccactggcctgcagccggtccgactcggcgccgctcctcccgccctggggttccgct
gcagggcgcggaggaggatggcgccctttggaaaggagcacgaggctttaatggggtgag
EXON 2  75 bp
tcgtcagggcagggaggggacttggcctccttcaggaccacctgccccgtctagaatgga
ctgaaactgggacagaacaggcaggccagtgggacctccaagtgcaggaggtggcgagcg
agctgccagggcccctgctgtgccccactcaccccctctctcacttctttctccacccag
ATCTGGGCACGAAAGCTTCTCTCTGTCCCTTGGCTTCTGTGTGGTCCCAGAAGATATGCC
TCCTCCAGTTTCAAG
gtgaaaggagggaactcgatgcttggctctgagagaggagggggctggcagctggttttg
ggcatctccaaaaggtccacagcccagagatggcagtgagtggtggtagcttaacagcct
gccattgggccgcagacaagggatgaaactgcatgtcccagaatcctccagggtgacagg
EXON 3  201 bp
gtggtagcttaacagcctgccattgggccgcagacaagggatgaaactgcatgtcccaga
atcctccagggtgacaggtccttcttctctatgggtctgaggcccagggcttcatgggag
ttgtagtttttcagctgggaggttgtggccagattctaggatacccctgtctttcctcag
GCTGCAGACCTGCAGCTGGAAATGACACAGAAGCCTCATAAGAAGCCTGGCCCCGGCGAG
CCCCTGGTGTTTGGGAAGACATTTACCGACCACATGCTGATGGTGGAATGGAATGACAAG
GGCTGGGGCCAGCCCCGAATCCAGCCCTTCCAGAACCTCACGCTGCACCCAGCCTCCTCC
AGCCTCCACTACTCCCTGCAG
gtggcatggcggccggcctctctccctgtccctgtctgcatctcctcctccttgctgtgt
ctcttgccaggtgtacctctcttggtttgtttgttgtgtgtttctcctttctgtgcattc
accatttgttttctgaggccttccatgctccaggctcatgcttggtgatgctgggttccc
EXON 4  111 bp
tatatctgtctctctttttctccatctctctgacccagctgctaaatctccccggtgctc
tcctcttggcctccatctttcagttgtctgtgtctttgtgtatctgtctctgtctgtctt
ggtgtctctcatgactgtctggagaagtctctgagcctccccacccgcgtgtccccgcag
CTGTTTGAGGGCATGAAGGCGTTCAAAGGCAAAGACCAGCAGGTGCGCCTCTTCCGCCCC
TGGCTCAACATGGACCGGATGCTGCGCTCAGCCATGCGCCTGTGCCTGCCG
gtgaggggtcccggtccaccggggtggggaggagggctggggccggggcagcaagggccc
cttgactcattcagaatcccacccagagtttcgacaagctggagttgctggagtgcatcc
gccggctcatcgaagtggacaaggactgggtccccgatgccgccggcaccagcctctatg
EXON 5  120 bp
ggcgttcaaaggcaaagaccagcaggtgcgcctcttccgcccctggctcaacatggaccg
gatgctgcgctcagccatgcgcctgtgcctgccggtgaggggtcccggtccaccggggtg
gggaggagggctggggccggggcagcaagggccccttgactcattcagaatcccacccag
AGTTTCGACAAGCTGGAGTTGCTGGAGTGCATCCGCCGGCTCATCGAAGTGGACAAGGAC
TGGGTCCCCGATGCCGCCGGCACCAGCCTCTATGTGCGGCCTGTGCTCATTGGGAACGAG

gtgggcccaactccagggctgggaagctgggctgcgggggttggattctgcagggcaggg
gtggggtcctggaggcctgggcctggggacgggaagggactgggggcctggactcctgac
gctgtccctttgcccgtcgcagccctcgctgggtgtcagccagcccacgcgcgcgctcct
EXON 6  164 bp
ccagcctctatgtgcggcctgtgctcattgggaacgaggtgggcccaactccagggctgg
gaagctgggctgcgggggttggattctgcagggcaggggtggggtcctggaggcctgggc
ctggggacgggaagggactgggggcctggactcctgacgctgtccctttgcccgtcgcag
CCCTCGCTGGGTGTCAGCCAGCCCACGCGCGCGCTCCTGTTCGTCATTCTCTGCCCAGTG
GGTGCCTACTTCCCTGGAGGCTCCGTGACCCCGGTCTCCCTCCTGGCCGACCCAGCCTTC
ATCCGGGCCTGGGTGGGCGGGGTCGGCAACTACAAGTTAGGTGG
gtaagtagcacccccatccccagaacgactggcgcactgggcgttggagacacagggacc
agcgtgcgtgctttcggccatgcctctggatgtcacatgaaggtgacatcatcagcaccg
tgcagggctcagtgctaagtgacctccctggtccctgaaaacaaaccatggaaggaagga
EXON 7  143 bp
ataaccatttagggtcctgatgccaaatgaaaagtcaaggattccatctcaggggaactg
gggagccctgtgagagctgtgagcagggagacgggagagagtaggatgagcctcctctgg
ggctgggctggggaaggatggggctcccttgccccacccaaccagactgccctccaccag
GAATTATGGGCCCACCGTGTTAGTGCAACAGGAGGCACTCAAGCGGGGCTGTGAACAGGT
CCTCTGGCTGTATGGGCCCGACCACCAGCTCACCGAGGTGGGAACCATGAACATCTTTGT
CTACTGGACCCACGAAGATGGGG
gtaagcccacccatgacccagcccgaaccctggtggaagtgggtggcaccatcattcctg
gcaggttacaggccccagggattctgggatgggggaagggggtggctcttaagacggcgg
tgctagggggtgagaggtaacatcttccaccccttacacctgccctagtgctggagctgg
EXON 8  86 bp
acgaagatgggggtaagcccacccatgacccagcccgaaccctggtggaagtgggtggca
ccatcattcctggcaggttacaggccccagggattctgggatgggggaagggggtggctc
ttaagacggcggtgctagggggtgagaggtaacatcttccaccccttacacctgccctag
TGCTGGAGCTGGTGACGCCCCCGCTGAATGGTGTTATCCTGCCTGGAGTGGTCAGACAGA
GTCTACTGGACATGGCTCAGACCTGG
gtgaggacatggcatcttctggtgatgggcgccatgtgccaggggccagggcatcagagg
gctgggactggggcacactggcatgtctctgccccttctcctgggtctgtctctcccgtt
gggcctctgtctttctcactatcctcagggagggagaggtggaggtctgcagcagggcaa
EXON 9  141 bp
ccaggggccagggcatcagagggctgggactggggcacactggcatgtctctgccccttc
tcctgggtctgtctctcccgttgggcctctgtctttctcactatcctcagggagggagag
gtggaggtctgcagcagggcaaccctctggggacacgtgtctctgccaactgccctgcag
GGTGAGTTCCGGGTGGTGGAGCGCACGATCACCATGAAGCAGTTGCTGCGGGCCCTGGAG
GAGGGCCGCGTGCGGGAAGTCTTTGGCTCGGGCACCGCTTGCCAGGTCTGCCCAGTGCAC
CGAATCCTGTACAAAGACAGG
gtgaggcggggctgccattgtgggtgggagggaaggaggggaggggcttggtcctcaccg
caccttctgtcccagaacctccacattcccaccatggaaaatgggcctgagctgatcctc
cgcttccagaaggagctgaaggagatccaggtgagctgcagggagctggggaatgggctg
EXON 10  75 bp
aagcagttgctgcgggccctggaggagggccgcgtgcgggaagtctttggctcgggcacc
gcttgccaggtctgcccagtgcaccgaatcctgtacaaagacagggtgaggcggggctgc
cattgtgggtgggagggaaggaggggaggggcttggtcctcaccgcaccttctgtcccag
AACCTCCACATTCCCACCATGGAAAATGGGCCTGAGCTGATCCTCCGCTTCCAGAAGGAG
CTGAAGGAGATCCAG
gtgagctgcagggagctggggaatgggctgggagcttgttccctggagaagttggtgtcc
catgagcccctggactaacagccagcctccttcagtagtaccaggaacagataatggcct
ttcttattgaggccctggagagtgggctttctgtgctgctctgtggcctggaaaacccct
EXON 11  401 bp
tgcgccgccttagccttgattccccgttcccatcattgttggggccctctgggaagtgga
ctacatttcccgtgagccgctggggcacagctccgtaggcactcggcctggaacacccca
gggcctactgggagttgtagtgcagcttccacctcacgcactgcctccgttgttccgcag
TACGGAATCAGAGCCCACGAGTGGATGTTCCCGGTGTGAAGCTGCAGGCTGTGCTCCAGA
TCCACCGACCCGTAGCATCTCGTCACGCCAGCACTCGCCTCCCTACCAATGACTCACCTG
AAGTGCAATACGAAATAAAAGGCCAGCGGGCGGCGTCTGGGTCTCTGGCGCCCCCATGTG
GTTGCGACACTCCCAAAGCCGTAAGGGCCGACCCAGGCATCTTGGCCCCCAGCCCCTCGT
CGCGGGTTCAGGTCCGCCCATTACTCCTTGTCGTGCGGTCAAGGATACACCTTGGCCCCG
ATTCCGGATCTCTCCGTTCTCAGGCCAGACCCCTGGTGCTGCCGTTGATTTTTTTTTCTC
TGTCTTTGCTGCAATTTTGAAATAAAATGCCAAAGAACACA
cattgtcgggcttcttcagtgacgtgactctggggctttaacccaggaatcctgcttcct
cagcccattttattctgaaggactcagtcatccgagcccccagtgttctgatggtttctc
caacctgggggagcatttcatgtctccggcactgaacttactatctgccccccaccaacc