--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (19582 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        867       1021   1   Internal    155    78        Good
tcagaggactttacccccacgccgtgtctgcctgtgtgaactcaagcctctgataagctc
tccattttctgccagggctgaggtgtctggaaatcggacagtttaagaggcctccgtcca
ccgcgtctcccggccgctgtgccttctgtacgtcacgtactcaaagatggccgcccccag
AGCGGCGAGGCGACGCCGGCGCGGACGCGTCTCCTCCTGAGGAAAAGCCGGAAGGCCGCA
TTCCGCTCTCCATGGAAACGCGGCTGACCGTCTCTGGAGGTTTAGAGGGGGAGGGAGTTG
GGCGAGGGGCCCAGAAGTGGAAGAAGTTTAGGGAA
gtaagttcagcttttaagaggtcgcggcgattccaaggagagtcaggtcagtgtgtgggt
cagggcgtggaaacgtggtgggagggagctttctgagggcgtctgcgttgttggtggcgc
tatatggtggaggtagcgcgggggttgggggaggcgggggcgggtgtttccttttggagg

Exon  2 +       8156       8324   0   Internal    169   100   Excellent
tggggcactgtgcaattatagaatacttggagattctctggcaatattaaaaaatacaat
agacttatagatggatgcagtctatatgtttaatgtgagcgggacaacttcccttcactt
tcttttcatgtcagtaaaagagaaacacttcctattaagcaaggctctgttttcttacag
GAATTGCTGACACTGGAGGATGTTACTGTGGAGTTCACCTGGGAGGAGTGGCAGCTCCTG
GGCCCTTTTCAGAAGGATTTGTACCGGGATGTGATGTTGGAGATCTACAGCAACCTGCTA
TCAATGGGTGAGGACAGCTGCTCTGTGTCACCTGGAGGGTGCCCAGTCT
gtggcctttgctttctcagttgcttacccttggaagttactgcagtgctctgaatattag
atttttggcacatcctctggcttctgataaaaggatataccgtcacccctcagtgtccaa
gagggattggtttcacaactttccatggatatgaaatccacagatgctcaagtctcatat

Exon  3 +       9179       9274   1   Internal     96    99   Excellent
tgaatccctggatgtgaaattttcagatattaaggtctgactgtaatctgccctttcctg
agagagaagcctctactttcagatgtgaaaactgtctagttacttaaatgtaacattctc
tcacattacataccccagcccaatccagtgtgtctgtcttctattatttcccgtaaacag
GTTATCAAGTCAGCAAACCAGATGCACTCTCCAAGTTGGAACGAGGAGAAGAACCATGGA
CAATGGAAGATGAAAGGCACAGTCGAATCTGTCCAG
gtatgtgagaagcagcaagatgcgtaagtaatattatagtcagtgaaagaaggctctgtg
ggtgtctgaggacacagaagcagtgcctacattaggaatgggaatcgttttccctccaca
agaaacccttcccatcttattttaaggttgcattctcctttagtaccatacatctgtcct

Exon  4 +      14322      14444   1   Internal    123    98   Excellent
gcggaggttgcagtgagctgagatcataccactgcactccagcctgggtaacagagcgag
actctgtctcaaaaaataataataataaacaaaataaaacaccaaggatttttttttcta
agaagacagttttatccccaacaagattataaaaggattcattgttctcttctttcctag
AAAACAACGAAGTTGATGATCATCTGCAGGATCACTTGGAAAATCAAAGGATGCTGAAGA
GTGTGGAACAATACCATGAACATAATGCATTTGGAAATACTGCCTCTCAAACCAAAAGCC
TTT
gtcttttcagggaaaatcatgatacatttgagttatatataaaaactttgaaatcaaatt
taagtttagtcaaccagaacaaaagctgtgaaattaacaactctactaaatttagtggag
atgggaaatcatttcttcatggtaactatgaagaactttattctgcagctaaattctctg

Exon  5 +      14322      16042   1   Terminal   1721    73        Good
gcggaggttgcagtgagctgagatcataccactgcactccagcctgggtaacagagcgag
actctgtctcaaaaaataataataataaacaaaataaaacaccaaggatttttttttcta
agaagacagttttatccccaacaagattataaaaggattcattgttctcttctttcctag
AAAACAACGAAGTTGATGATCATCTGCAGGATCACTTGGAAAATCAAAGGATGCTGAAGA
GTGTGGAACAATACCATGAACATAATGCATTTGGAAATACTGCCTCTCAAACCAAAAGCC
TTTGTCTTTTCAGGGAAAATCATGATACATTTGAGTTATATATAAAAACTTTGAAATCAA
ATTTAAGTTTAGTCAACCAGAACAAAAGCTGTGAAATTAACAACTCTACTAAATTTAGTG
GAGATGGGAAATCATTTCTTCATGGTAACTATGAAGAACTTTATTCTGCAGCTAAATTCT
CTGTAAGTACAAAAGCCAATAGCACTAAATCCCAAGTCAGTAAGCATCAGAGAACTCATG
AAATAGAAAAAAACCACGTATGCAGTGAATGTGGGAAAGCGTTTGTCAAGAAGTCTCAGC
TCACTGATCATGAGAGAGTTCATACAGGAGAAAAACCTTATGGATGTACTTTGTGTGCAA
AAGTGTTCTCCAGAAAGTCCAGGCTAAATGAACATCAAAGAATTCATAAAAGAGAGAAAT
CTTTTATATGCAGTGAATGTGGAAAAGTCTTCACTATGAAGAGCCGTCTGATTGAACATC
AGCGAACTCATACTGGAGAGAAACCCTACATATGCAATGAATGTGGAAAAGGCTTCCCAG
GCAAGCGTAATCTCATTGTACATCAGCGAAATCATACTGGAGAGAAATCCTATATATGTA
GTGAATGTGGAAAAGGCTTCACTGGGAAGAGCATGCTTATTATACATCAGCGAACTCATA
CAGGAGAGAAGCCCTACATCTGTAGTGAATGTGGGAAAGGCTTCACCACAAAACACTATG
TCATCATACATCAACGAAATCATACAGGAGAGAAACCATATATATGCAATGAATGTGGGA
AAGGCTTCACCATGAAGAGCCGTATGATCGAACATCAACGAACTCATACAGGAGAGAAAC
CCTACATATGCAGTGAATGTGGAAAAGGCTTTCCCAGGAAGAGTAATCTTATTGTACATC
AGAGAAATCATACAGTAGAGAAGTCATATCTATGTAGTGAATGTGGAAAAGGTTTTACTG
TGAAAAGCATGCTCATCATACATCAGCGAACTCATACAGGAGAGAAGCCCTACACATGCA
GTGAATGTGGGAAAGGCTTCCCCTTGAAGAGTCGGCTGATTGTACATCAGCGAACTCATA
CTGGAGAGAAACCTTACAGGTGCAGTGAATGTGGGAAAGGTTTCATTGTGAATAGCGGAC
TGATGTTACATCAGCGAACTCATACTGGAGAGAAACCGTACATATGCAATGAATGTGGAA
AAGGTTTTGCCTTTAAGAGCAATCTTGTTGTACACCAGCGAACTCATACTGGAGAGAAAC
CCTTTATGTGCAGTGAATGTGGAAAAGGCTTCACCATGAAACGCTATCTCATTGTACATC
AGCAAATTCATACAGAAGAGAAATCTTGTATATGTAGTGAATGTGGAAGAGGCTTTGCCA
AGGAAACAGAGCTTGCTTTACATAAGCAAGTTCATACTGGAGAAAAACCTTATGGATGTA
ATGAATGTGGTAAAGGCTTCACTATGAAGAGCCGTCTAATTGTTCATCAACGAACTCATA
CAGGAGAGAAACCCTTTGTATGCAGTGAATGTAGAAAAGCCTTCTCCTCAAAGAGAAATC
TCATTGTACATCAGCGAACTCATAATGGAAACAAACCCTGA
caatgcagtggacatgttcatgcctttgggaagaaaatctgccttgtacaacatcagaga
tttcacagtatagattttctacatgtgtactgagtatgaaaaatcatatttcaaaatcca
gtgttattcactaggatgaatgctatcaatgtcagaaaggcttcaacatgaattcaggct

--------------------------------------------------------------------------------