--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (24385 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       3264       3376   0    Initial    113    79        Good
aatttcatcagaacctttcaaaagaattttctttaacccaggcatgtgaaagatgcttct
ctaattttaaggatgggatgataagaccagtccatcccattagcccttccaggcccccat
gtaagaattcaggcacaccttctcactcatctcagaccttctcagggtaacttcgtgaaa
ATGTTTCCAGCTCTGAGCCCCAGTGAGCCTCCCCTGCAACTTGGAGATGAGGGGCTAGAC
CAGAAAAGCTCAACCCGAGTGACCCTGGCCACTGAAATGATTGGCAAAATAGA
gtgggtgtctgggtgtggctttttttctggtagaggggagtgcccagttgtaattagaat
tttcagtgggatgcagtaccccaaaaatgaaaaaaaaaagcaatagaatggaagaaagag
agtggtagactcagaaagagagaccatcttcggaggactttgtctgtattagaatatcac

Exon  2 +      12503      12631   0     Single    129    40        Poor
tgatgcctggtctgttggttcgctttgggatcaccttgatttgccttcctctaaataggg
actcatccaaggccaaggaagtcctcactgactctttgagaactctatatatgcaaaccc
tttgggatggccactaaatttgtcacagagtatggtaacgtggttgactgaaccacagcc
ATGAAAGTGAGCTTCCAGCTCTTCTGCTGTTGCACCGCAGTCCACATTGCCAGCATTGAT
GGAACGGGCATCAGCCTCCATCTTCTCCTCAATGGACGTGATCACTGGGCCAGCATTGCC
TGGAGGTAG
actcatattcctctgcttctctacgtcgttctgtagctcctttagcttctcagcttcttc
ctccacctccctgactccagcttcgatagcttccagccccgggtcaccctcgaccagtcc
cggctcctccccctcctcttggctgccggtggctcctgaacgaggcccaggtcctggagc

Exon  3 +      14758      14899   2   Internal    142    87        Good
cttcaaaaagtataataaaaacatcatgtggtgaaaaatccgtcactcggatttgtgaga
acattcactacaactaaatccatgctttccccctctcttgtcattttctgtaaagataag
aactccaccataaccatttggttaaaatgtgtttccatttcagggtctattgacattcag
GGACGTGGCCATAGAATTCTCTCAGGAGGAGTGGAAATGCCTGGACCCTGCTCAGAGGAC
TCTTTACAGGGATGTGATGCTGGAGAATTATAGGAACCTGGTCTCCCTGGGTGAGGATAA
CCTCCTGGGGATGTGCCCTTGT
gtatctttgtattttctcttgttgcctcttgggagccacatccttacttgactaaaatgg
aagccgtattgattttgaaatgaaaagcttcatgatgtagcatctggactttcactgtcc
cctttgtttagaggttctgcattcttcatgatagctcagtggagcttccagaagtaaagt

Exon  4 +      21192      23186   0     Single   1995    91   Excellent
ttatttattaaagaatcttactccttttgtgttcttaaactttgaagatcatgtttggga
agtttaaaataagtattgttttttgtgtcatatttacacatttcagtattatacaccatc
tgtacttcattggaaacctattggtgtttatattttgtagatatctcttccaaatgcatg
ATGAAGACATTCTTCTCAACAGGGCAAGGCAATACAGAAGCGTTCCACACAGGGACATTG
CAAAGACAAGCAAGTCATCACATTGGAGATTTTTGCTTCCAGAAAATTGAGAAAGACATT
CATGGCTTCCAGTTTCAGTGGAAAGAAGATGAAACAAATGACCATGCAGCACCCATGACA
GAAATCAAAGAGTTGACTGGTAGTACAGGCCAACATGATCAAAGGCATGCTGGAAACAAG
CATATTAAAGATCAGCTTGGATTAAGCTTTCATTCGCATCTGCCTGAACTGCACATATTT
CAGCCTGAAGGGAAAATTGGTAATCAAGTTGAGAAGTCTATCAACAATGCTTCCTCAGTT
TCAACATCCCAAAGAATTTGTTGTAGGCCCAAAACCCATATTTCTAATAAGTATGGAAAT
AATTCCCTCCATTCTTCATTACTCACACAAAAACGGAATGTACACATGAGAGAAAAATCT
TTCCAATGTATTGAGAGTGGCAAATCCTTTAATTGTAGCTCACTTTTAAAAAAACATCAG
ATAACCCACTTAGAAGAGAAACAATGTAAATGTGATGTATATGGCAAGGTATTTAATCAG
AAGCGATACCTTGCATGCCATCGTAGATCTCACATTGATGAGAAACCTTACAAGTGTAAT
GAGTGTGGCAAGATCTTTGGTCACAATACATCCCTCTTCCTTCACAAGGCGCTTCATACT
GCAGACAAACCTTATGAATGTGAAGAATGTGACAAAGTTTTCAGTCGCAAATCACACCTT
GAAACACATAAGATAATTTATACTGGAGGGAAACCATACAAATGTAAGGTTTGTGACAAA
GCTTTCACATGTAATTCATACCTAGCAAAACATACTATAATTCACACTGGAGAGAAACCT
TACAAGTGTAATGAATGTGGCAAGGTTTTTAATCGACTGTCAACCCTTGCACGCCATCGT
AGGCTTCATACTGGAGAGAAACCTTATGAATGTGAAGAATGTGAAAAAGTTTTCAGTCGC
AAATCACATCTTGAAAGACATAAGAGGATTCATACTGGAGAGAAACCATACAAATGTAAG
GTTTGTGACAAGGCTTTTGCATATAATTCATACCTGGCAAAACATAGTATAATTCACACT
GGAGAGAAGCCTTACAAGTGTAATGAATGTGGCAAGGTTTTTAATCAACAATCAACTCTT
GCACGCCATCATAGACTTCATACTGCAGAGAAACCATACAAATGTGAAGAATGTGACAAA
GTTTTCAGGTGCAAATCACACCTTGAAAGACATAGGAGGATTCATACTGGAGAGAAACCA
TACAAATGTAAGGTTTGTGACAAGGCTTTCCGGAGTGATTCATGCCTTACAGAACATCAG
AGAGTTCATACTGGAGAGAAACCATACATGTGTAATGAATGTGGCAAGGTTTTTAGTACA
AAAGCAAACCTTGCATGTCATCATAAACTTCATACTGCAGAGAAACCGTACAAATGTGAA
GAATGTGAGAAAGTTTTCAGTCGCAAATCACACATGGAAAGACATAGGAGGATTCATACT
GGAGAGAAACCGTACAAATGTAAGGTTTGTGACAAGGCTTTCCGGAGGGATTCACACCTG
GCACAACATCAGAGAGTTCATACTGGAGAGAAACCTTACAAGTGTAATGAGTGTGGCAAG
ACCTTCCGTCAGACATCATCGCTTATAATCCATCGTAGGCTTCATACTGGAGAGAAACCT
TACAAGTGTAATGAGTGTGGCAAGACCTTCAGTCAGATGTCATCCCTCGTATACCATCAT
AGGCTTCATAGTGGAGAGAAACCTTACAAGTGTAATGAATGTGGCAAGGTTTTTAATCAA
CAAGCACACCTTGCACAGCATCAGAGAGTTCATACTGGAGAGAAACCTTACAAGTGTAAT
GAGTGTGGCAAGACCTTCAGTCAGATGTCAAACCTTGTATACCATCATAGACTTCATAGT
GGAGAGAAACCTTGA
aagtgtaatgagtgtggcaagaccttcagtcagatgtcaaaccttgtataccatcataga
cttcatagtggagagaaaccttaaaagtgtaatgagtgtggcaacaccttccatcacaat
tcaacccttgtaagtcacaaagccattcatactggagagaaactttacaagtgtaatgaa

Exon  5 +      23499      23860   0    Initial    362    59    Marginal
agtcacaaagccattcatactggagagaaactttacaagtgtaatgaatgtggcaaggtt
tttaatcaaaaaacaacccttgcacgtcatcatagaattcatactgcagagaaactttac
aaataggaagaatgtgacaaagttttcggttgcaaatcaaaccttgaaacacataagaaa
ATGCATGCTGAAGAGAAACCACACAGATGTAAGGTTTATGACAAGATTTTTGAATATAAT
TCATACCTGGCAAAACATATTAGAATTCAAACTGGAGAGAAACCTTACAAATGTGATGAG
TGTGGCAACACCTTTGGTCAAAATTCATACCTTGTAATTCAAAAGGCAATTCGTATTGGA
GAGAAACCCTACAAGTGTAATGAATGTGGCATAGTTTTTAATCAACAGTCACACCTTGCA
AGTCATCATAGTCTTCATACTGCAGAGAAATCTTACAAATGTGAAGACTGTGACAAAGTT
GTCAGTCACAAATCACAGCTTGAAAGACAGGAGAATTCATACTGGAGAAAAAACATACAA
AT
gtaaggtttgtaacaaggcttttgggagtgattcacacctggcacaccatactagaattc
acactggagagaaaccttacaagtgcaatgagtgtggcaaagcctttagtgggcagtcac
cacttattcaccatcaagcaatccatagtatagggaaacttgactaatataatgattgtc

--------------------------------------------------------------------------------