--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (12635 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1234       1443   0    Initial    210    83        Good
cctcgagtctcaggtaagcgggaaatcccacttcacaagaaagcccctctctccgaggca
cgggcgcatgcgcgggtcggccacccgctggggccgcggggccgccgctctggcccgcgt
ggggcagtcgtccgcgtctcgctcatgatgacgcacgtccggggcggtggggaaggcaag
ATGGCGGCGCCCATGGAGGTGGCCGTGTGTACGGACTCGGCGGCCCCGATGTGGAGCTGC
ATCGTGTGGGAACTTCACTCGGGCGCCAACCTGCTCACCTACCGCGGCGGCCAGGCGGGA
CCCCGCGGCCTGGCGCTGCTCAATGGCGAGTATCTGCTGGCGGCGCAGCTGGGCAAGAAT
TACATCAGCGCCTGGGAGCTCCAGCGGAAG
gtgcggcggtgcggtctcgctgctggggtcatggggcgcccgaggctgaagtcgggggat
gggttggtgggggccgcgtgcacccttagtcggaattggcgtggggaggggaggtggtct
ccgttcgggcgctctgcgcatgcgcgggtctgggggctttggggagatacgtgcgacctg

Exon  2 +       6404       6561   0    Initial    158    74        Good
caggccaccacagcctgcccagaagcgacttcctgttgaatggtgggagccgcctgcagg
tcctgagtgcagccgttcctacggggcccacacaggacgcctggggtcaggctcacaggg
gaccagcacctccctgaggcagcagggaagggcaggaaacttgccccttcctgggccatc
ATGCAGGTGGGGACGAGGCGGGAACAGGTGCCCACCCAGCCCAGGCAGGGGCGCGACGAG
GCCCCGCTGTACCTGCTGGCCGCTGCCCTGACAGGGTCACCCCGCAGTCCTGGGGCAGGG
CAGGCAGGGGGCGACAGTGTGGCCATGGCCGTGCAGTG
gtgggttcctggggctgcagcccccctttcctcccctggggctttcctcccctgacctgg
ataccctctgcccctcacaggtctccaccgggaaccttctggtcatcctgagtcgacact
accaggacgtctcctgccttcagttcacaggggacagcagccacttcatctcagggggca

Exon  3 +       6642       6758   0   Internal    117    90   Excellent
aggccccgctgtacctgctggccgctgccctgacagggtcaccccgcagtcctggggcag
ggcaggcagggggcgacagtgtggccatggccgtgcagtggtgggttcctggggctgcag
cccccctttcctcccctggggctttcctcccctgacctggataccctctgcccctcacag
GTCTCCACCGGGAACCTTCTGGTCATCCTGAGTCGACACTACCAGGACGTCTCCTGCCTT
CAGTTCACAGGGGACAGCAGCCACTTCATCTCAGGGGGCAAGGACTGCCTGGTGCTG
gtttggagcctctgcaggtagcgccttgcgcactcaggcctgcacctggaactgcacccg
ggctcaggcggggagaggaggcgccaaggcccctggcgggaaggggcttctctcttgggg
gctggagtgcagaggacggagtgatcatcccaggggtcctggctgcccacactggggtct

Exon  4 +       6984       7244   0   Internal    261    55    Marginal
ctggaactgcacccgggctcaggcggggagaggaggcgccaaggcccctggcgggaaggg
gcttctctcttgggggctggagtgcagaggacggagtgatcatcccaggggtcctggctg
cccacactggggtctggtttgttctgggggccgtgggggcccagccttgagtttactcag
GTGAGGCAGGCCAGGCTGCTGAGTGGAGGCAGGTGTGTGCGTGAGGTGGGTGCTGGAGGC
GTGGACTGCCCTGTTCCCTCCGCTCCCCGCCTGCTGAGCACCTGCCCCACCCCGCTCAGC
GTGCTGCAGGCCGACCCCTCCAGGATTCCGGCGCCCAGGCACGTCTGGTCTCACCACGCG
CTCCCCATCACGGACCTGCACTGCGGCTTTGGGGGCCCCCTGGCCCGGGTGGCCACCTCC
TCACTGGACCAGACGGTGAAG
gtacgccgcccccaccccaccacggtccatgagcggagcccagcagccgcaggtcctcag
ccaggaatgcaggaatcgcctcctcccgctccctgctgtcaggactccagacggctttta
atcccctggtgctctgagcccaaggacgtccagggaggtctgccagcctggaaattccta

Exon  5 +       7732       7875   0   Internal    144    83        Good
atttcagcacaggccatgtcccctggcccccaagacccacatggtgacggctttcaccca
aagtcgcaagccctagggccagaggacagccgacgcctgacctccctggtgcccctgttc
ccatggggtcctcgggttccccctgccgggccgagccccacgccctttgcccacccgcag
CTATGGGAGGTCTCCTCGGGGGAGCTGCTGCTCTCCGTCCTCTTTGACGTGTCCATCATG
GCAGTGACCATGGACCTGGCTGAGCACCATATGTTCTGCGGGGGCAGTGAGGGCTCCATC
TTCCAGGTCGACCTCTTCACCTGG
gtgagtgccgcggtctgcgggctgcaccctgccctggggctgagggcatcgggcctgcgg
ctcacacacgtctcggccttcgcagcccggacagagggagaggagcttccacccagagca
ggacgccgggaaggtcttcaaagggcacaggtggggacgtgggaacggggcgggggctcc

Exon  6 +       8084       8231   0   Internal    148   100   Excellent
ctgccctggggctgagggcatcgggcctgcggctcacacacgtctcggccttcgcagccc
ggacagagggagaggagcttccacccagagcaggacgccgggaaggtcttcaaagggcac
aggtggggacgtgggaacggggcgggggctcccaggcacgtcctgtctggcacgtcccag
GTGACCCCTGTCTGTCTGTCCAGGAACCAGGTGACTTGCCTGTCAGTGTCCACTGACGGC
AGCGTGCTGCTCTCAGGCTCCCACGACGAGACCGTGCGCCTCTGGGACGTGCAGAGCAAG
CAGTGCATCCGGACGGTGGCCCTCAAAG
gtgggcgcgcctctgctcggcccgcggccagcgcgcaggggaaaaagccagcaggagctc
cgggcttggcttgggtgggggcggggactggtttgctgtggggcggggccgggctggggg
cgtggactggctgtggggcggggcctggctgggggagtggactggctgtggggcgtgggc

Exon  7 +       8835       9001   1   Internal    167   100   Excellent
gggtggggcctggctgggggcgtggactggtcgtggggcggggcctggctgggggcgtgg
actggctgtggggcggggactggctgggggcggggactgccctggatggggcggaacttg
gcttgctgtggggtggggcctggctgggatggggcggggcctgacctccgcgccccccag
GCCCAGTCACCAATGCCGCCATCCTGCTGGCGCCCGTCAGCATGCTGAGCTCAGACTTCA
GGCCCAGCCTGCCGCTGCCCCACTTCAACAAGCACCTGCTGGGCGCCGAGCACGGGGACG
AGCCGCGCCACGGGGGCCTCACTCTGCGCCTGGGCCTCCACCAGCAG
gtacggcccccagcagggaacccccactgcccttttgtcccggaagaccccgcgggccct
gggctccttcgctcccttggtcctggcgcccgtgcggcggttccccacaagcccggcact
ggagggcgcgtcctgtgagtgggatggtgatgctcggtggggcctctgcccactctcagt

Exon  8 +      10481      10742   0   Internal    262    64    Marginal
cttcctcccgtgacggctgctagtcctctgtgacccttgttccaatccagctgacactgg
aatgttggcctgtcccacagacaggcgctgctggggcccaaggcgcttcgtccaggaggc
gggttcccgacctctgatcccccagcaacgtccctccatgtaactggttcctctgtacag
GGCAGTGGCCTTGCTGGGCCGGCCAGGCTCTCCCCATGGCTGGAGGTGCTCACTGTCTGT
GAGGCCCTCGCCAGGCCCTGTGTCCCAGAGCCTTCCCTGGGCTTGCGGGTCCTTCCAGGT
CTGGCCCAGGCCCCTGTCTGTGGTGTGGCCATCTGCACCCCCATCCCCAGCCACATCCTT
GGGCGCAGTCGTGGAGGATCTGAGGCGCTGGGTAATGACTGCATGGCCAGGGTCAGGGTT
GTCATCTGCAGGCTCGACGGAG
gtgaacgcccccgtctcagtcttcccttctgtctgtgggcgtcacggtggcccctccctg
gctgagtggctgcccacgctggcgggggtgggatgggcaaagcgtgtggtgtgtgacagg
acgcgccccgaggtcacgtggctccctgtgttacagggctcggagcccagctacctggac

Exon  9 +      10899      10967   0   Internal     69   100   Excellent
ttgtcatctgcaggctcgacggaggtgaacgcccccgtctcagtcttcccttctgtctgt
gggcgtcacggtggcccctccctggctgagtggctgcccacgctggcgggggtgggatgg
gcaaagcgtgtggtgtgtgacaggacgcgccccgaggtcacgtggctccctgtgttacag
GGCTCGGAGCCCAGCTACCTGGACCGCACGGAGCAGCTGCAGGCCGTCCTGTGCAGCACC
ATGGAGAAG
gtgggcggggcctcgggaggggcggggcctgaggctggggtcagtcctggccagtggggg
tgagtggcccccctccagcacaccccaggccacttctgccctctgaccccgacttctccc
gcagagcgtgctcggcggccaggaccagctgcgcgtccgtgtgacggagctggaggacga

Exon 10 +      11092      11223   0   Terminal    132   100   Excellent
gctacctggaccgcacggagcagctgcaggccgtcctgtgcagcaccatggagaaggtgg
gcggggcctcgggaggggcggggcctgaggctggggtcagtcctggccagtgggggtgag
tggcccccctccagcacaccccaggccacttctgccctctgaccccgacttctcccgcag
AGCGTGCTCGGCGGCCAGGACCAGCTGCGCGTCCGTGTGACGGAGCTGGAGGACGAGGTG
CGCAACCTGCGCAAGATCAATCGGGACCTGTTCGACTTCTCCACGCGCTTCATCACGCGG
CCGGCCAAGTGA
ggcccggagaccccggcccgaggcgcccaggcctgagccccatgcctcccagcaaccagg
gcccgcgggtgtggcccccaccagcccaggcctggactctcctcagttctgtgtcgtgtt
cgggtttttcctctgtgactgggccgtcttggtgtctcgtggcacgcgtcacagtggtgc

--------------------------------------------------------------------------------