--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (28483 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (11 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        733        864   0   Internal    132   100   Excellent
cactatcaggtagcatggatggcgtggtgcatgctatcgcaacccctgttctacagataa
ggaaactgatgcccagagagagacggaggactcttgtgaatattgggggggaccgcccct
gcacctcggggacgtgaccccccccccaggctgacccgttcctcgctctgtcgtccccag
GTGGAGGAGGAGCTGACGCACCTCCAGAAGAAACTAAAAGGGACAGAGGACGAGCTGGAT
AAATATTCCGAGGACCTGAAGGACGCGCAGGAGAAGCTGGAGCTCACGGAGAAGAAGGCC
TCCGACGTACGT
gtgcagggatgcgggagcccgcggcggggccaggccggagccccggggccgggaaggcgg
ggagagccgcagggggaggaggaagaggaggaggagaaggcggcgcctcccagcgctttc
tccaaataagtcccgaaaaggggcactttccagcagctgtggccagcggtgccgacgtca

Exon  2 +       1252       1383   0    Initial    132    87        Good
gcggtccggccgggtgacctcatcgccccgacggcagccggcccggggggcggggagagg
cgggggcggcccccgcgcaggcaaaggcttggggggccggggcgcggctgtgcagctctc
gccggagccgagcccagccgagcgtccgccgctgcccgtgcgcctctgcgcctccgcgcc
ATGGCCGGCCTCAACTCCCTGGAGGCGGTGAAACGCAAGATCCAGGCCCTGCAGCAGCAG
GCGGACGAGGCGGAAGACCGCGCGCAGGGCCTGCAGCGGGAGCTGGACGGCGAGCGCGAG
CGGCGCGAGAAA
gtgagcgccccggcctcgggccccgcacccgcagcctcctcccccgcgcgccctcctttc
ttcccggcttcccgcgctgcccgcccgcgcgcagtcctcgggccgcctttttacgccctc
ggacgccgatcgccgacccacatccctgcgcccgcagccaggaccccctacttcctccgc

Exon  3 +       6599       6732   0   Internal    134   100   Excellent
agacattttccgggaagatcatactgaaattttggtatgagtgtaaattccctatggcct
ggactcctgggtgggctttgacggggaagatcaggttaacagagggcaggacatggggga
ggctcccactggtggctggcctgatacttcttaacatggctgcacctccgacctccccag
GCTGAAGGTGATGTGGCCGCCCTCAACCGACGCATCCAGCTCGTTGAGGAGGAGTTGGAC
AGGGCTCAGGAACGACTGGCCACGGCCCTGCAGAAGCTGGAGGAGGCAGAAAAAGCTGCA
GATGAGAGTGAGAG
gtaaggacgctttgaatctggtggcatccgtgtttgcttttagaaaatggggatcatgct
gccgacctcgcagagctggtgtgaaagtaaacaaggtcacaaggacatgcatgtgtccac
aaaaaagtgcatgacagcactttgtaaaccatcactccatgggtagagatgtttatccgt

Exon  4 +      11109      11226   2   Internal    118   100   Excellent
aggaggctgaggcaggagaatcgcttgaacccgggaggtggaggttgcagtgagctgaga
tcgtgccactgcactccagcctggatgacagagcgagactccatctgaaagaaaagatag
atgagaggtgggtggaggggtgtgagtgaacggccgtcctgatgagattgctccttgcag
AGGAATGAAGGTGATAGAAAACCGGGCCATGAAGGATGAGGAGAAGATGGAGATTCAGGA
GATGCAGCTCAAAGAGGCCAAGCACATTGCGGAAGAGGCTGACCGCAAATACGAGGAG
gtgagtggggctggcagatggcgcagcagcaggaagtgggaggaaatgcatctgctgaga
tagggaggacaccggggccaacgaaaggaagctctcggttaggtcagctgtcctcctgcg
tgaacatatgtttgtccagagacaaccacttggctaggaaactatctcccacgatgccag

Exon  5 +      12713      12783   0   Internal     71    91   Excellent
ctccagcctgggcaacagagggagactccgtccccctgcaaaaaaaagaaacaccagaaa
aacccatgttgcagctggtctaggggtctgggtggggcatcattgggggctgtctgcagt
ggatgggagaggacacggctggtggggatcgggctcagctgggcctttctgtctctgcag
GTAGCTCGTAAGCTGGTCATCCTGGAGGGTGAGCTGGAGAGGGCAGAGGAGCGTGCGGAG
GTGTCTGAACT
gtgagtggcagaacaggactgagcgaggctggctcgattcctggggcggagtgggaagga
gctggctgtgttgggaattggctctgaccggggtctctgctcaagtggacgggcgtcagg
ggctcatggctcatcttttctcttggcttctgtgacaaagaggtggtgacttgttcttac

Exon  6 +      13731      13806   2   Internal     76    89        Good
gataagcccatagtatcacactgcagaaaaatccattaacattttctccccacattcctt
ctgccccccaccgggggagctgtgtaggtttctcctttggaaaatttattgttggggcga
ttgctattattgccggctgtaagggaagataagacacaaaaatcctttgtctttgtgcag
AAAATGTGGTGACCTGGAAGAAGAACTCAAGAATGTTACTAACAATCTGAAATCTCTGGA
GGCTGCATCTGAAAAG
gtaggtggttggcttgagctggagggtggcttgctggactttgttcttttcttctcccga
gggatgcaggagcctgtcaggttatggggaatctgccctttatttaacagtagcgttggt
gcctggcagccagggtttttcccctacagaaagagctggatttctcctgcacactcttga

Exon  7 +      14136      14270   0   Terminal    135    55    Marginal
aaagagctggatttctcctgcacactcttgagtcctcttccatggggtctgagcaccatc
tttgatctccatctcaggaggatagagatagaacatgaggctcttcttagcgagatctga
gcatagttgtataaataaatacagagcctgcctctcacctgattcccctggttcctccag
AAATACCATCTCAAAGGTATAGCAATGATCAGAGGTGGAATTGGGCTTTTTAGTTTGAAA
CAGCACCCAAAGCAGTTGCTACGTGGCAGCTACGTCGGGAACAAAGGACACACTTCCACG
GCCGAACCCCACTGA
atttcccagcctcttcctcattcttgctcctgcttttgcagtttcacagacattctttgt
tctcccatcacctccaccccccacttttttttttttttttttgagacagagcttcgctct
gttgcccaggctggaattcagtggcatgatcatagttcattgcagccttgaactcccagg

Exon  8 +      18222      18284   0   Internal     63    96   Excellent
tggctaatttttgtatttttagtagagacggggtttcaccatgttggccaggctggtctc
gaactcctgaccttgtgatccaccagcctcaggctcccaaagtgccaggattccaggcat
gagccaccatgcctggctgggcctccttttcttaaagcagtgttttggtttctcccacag
TATTCTGAAAAGGAGGACAAATATGAAGAAGAAATTAAACTTCTGTCTGACAAACTGAAA
GAG
gtgagtgtggtggcacccagcgagctctggtttctcctggggctggtcttgaagccatga
tagtaactcctttcttcttatctaggctgagacccgtgctgaatttgcagagagaacggt
tgcaaaactggaaaagacaattgatgacctggaaggtatgaggttaccatctaaatgttt

Exon  9 +      18370      18439   0   Internal     70   100   Excellent
ttcttaaagcagtgttttggtttctcccacagtattctgaaaaggaggacaaatatgaag
aagaaattaaacttctgtctgacaaactgaaagaggtgagtgtggtggcacccagcgagc
tctggtttctcctggggctggtcttgaagccatgatagtaactcctttcttcttatctag
GCTGAGACCCGTGCTGAATTTGCAGAGAGAACGGTTGCAAAACTGGAAAAGACAATTGAT
GACCTGGAAG
gtatgaggttaccatctaaatgtttgccttgccctgccttcccctctgggacacatccac
ggacagttggggaatgtttgtggaggggctgggttgggctttgtttgccttaggaaagta
aagcgcatagtgatgtcatatctggatgtcctggaacactggaataggataatgcaaagc

Exon 10 +      19950      20032   1   Terminal     83    87        Good
catagatctttggttttcttcatctgtttcacatggaacacagctttctcctagtctgtg
ctttgtttgctcacgtgtttttttcttcctcttgtggttcatctgtggcactccattccg
acccttgccttctgtcccctgtacttctgaactgtctccctggggacctccgccctctag
ATGAGTTATACGCTCAGAAGCTCAAGTACAAAGCTATCAGCGAGGAACTGGACCACGCTC
TCAACGACATGACCTCTCTCTGA
gaggcagccaggtcgctgccctctgtccttctcacatggtgcctcctacgcccctgtggg
cttctaggagctccggtggcctgccttctggtttgaacgtcagagccttcttctgatgtg
tctgtgactctacaaccgaaataaagacgggcagtcctcctcttcatgccccctcattct

Exon 11 +      25950      26032   1   Terminal     83    81        Good
ttgcttgagcctggcaggtgaaggttgcagtgagccaagatcgcgccactgcactccagc
ctgggtgacagaatgagaccctgtctcaagaagaagaaaaaaaaacaaatcttttttttt
ctttcatttaacaaagacgcttattaatttatctttccccatactcttaatcctcaccag
AGAAACTTGCCCAGGCCAAAGAAGAGAACGTGGGCTTACATCAGACACTGGATCAGACAC
TAAACGAACTTAACTGTATATAA
gcaaaacagaagagtcttgttccaacagaaactctggagctccgtgggtctttctcttct
cttgtaagaagttccttttgttattgccatcttcgctttgctggaaatgtcaagcaaatt
atgaatacatgaccaaatattttgtatcggagaagctttgagcaccagttaaatctcatt

--------------------------------------------------------------------------------