--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (30492 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (14 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       6128       6326   0    Initial    199   100   Excellent
tcctgctctagaggactggtcagtctgtgcttccctacaagagccctggacctcactctt
ctggatgagaagcgggtgatcccttcctttccctctgccctcctgactttgaccctaact
gaaccgaaagcagacccgcccggcactgggttttgtttctgcgtagcctgtgcaggagac
ATGGCGGACGCAGCATCTCCGTGCTCTGTGGTAAACGACCTGCGGTGGGACCTGAGTGCC
CAGCAGATAGAGGAGCGCACCAGGGAGCTCATCGAGCAGACCAAGCGCGTGTATGACCAG
GTTGGCACCCAGGAGTTTGAGGACGTGTCCTACGAGAGCACGCTCAAGGCGCTGGCCGAT
GTGGAGGTCACCTACACAG
gtaagtcccaggcagggtctgtgcgtgggccgcaggtgccgagggaggtggcaccgcagg
cgggagtagcccagcccgtggagccggttcagaacctggcttgaagtgtcaccagcaccc
tgcccctgagcacagggcagcgccacctgctcccaggctggtcgtggtggctaaatcaga

Exon  2 +      10457      10595   1   Internal    139   100   Excellent
gggcccagcctggaggggacggtggcgtgtgcctctagtcccagctacttgggaggctga
ggcaggagagagttcacggggggattcagcagacaggcctgggagaggggtccgggcaac
acctgccagttgtactggggcctgttctcacacctgtctccctggtctcccctgttttag
TTCAGAGGAATATCCTTGACTTCCCCCAGCATGTTTCCCCCTCCAAGGACATCCGGACAG
CCAGCACAGAGGCCGACAAGAAGCTCTCTGAGTTCGACGTGGAGATGAGCATGAGGGAGG
ACGTGTACCAGAGGATCGT
gtggctccaggtgagggggccctgcggggagtgcaaatagcctcccaagtaactaggatt
acaggcgcccgccaccacacccggctaatttttgtatttttagtagagacggggtttcaa
cgtgttggtcaggctagtctcgaactcctgacctcaagtgatccgcccacctcggcctcc

Exon  3 +      14084      14165   2   Internal     82    54    Marginal
gatagagacagggttttaccacattggccaggctggtctcaaactcctaacctcaagtga
ttcacccgccttggcctcccaaactgctgggattacgggtgtgagccactgtaccacagt
tatttttaaaaccccttcggcttgttgcatgcccagcatgtgtggccatgtgcatggtag
AAGCCACAAACTCTCCCACAAGGGCCAGCAAGCAAGGAGGGAGCAGAGGCAGCCCCGCCT
GGAGGACAGAAGCGCGGAAAAG
gtgcgaggtccggatgctggcgagcagagttccagcgcgtccccgcggcccttagggcca
gcgctgtgtgctcattgagtctccagagccttccctggcatggctgggtttgttatgtga
gatggcaagagggggagacattgggaattgcccagcatggggcctgttcccaggagaggc

Exon  4 +      15382      15484   0   Internal    103   100   Excellent
cctccgtgtctgtctgtcctccgcctcccgtctcactctttcctcctcggttgcctcttc
tttcggcctggttcttggggaaatccctcagccctcggcgagagggttcccaggcgttgc
gtctccccgcggagcccgccccggtctctccctcccctcacgccccgcctttctctccag
AACATCAAACGCATCAAGAAGAAGCTGAGCCTTCTGTGCATCGACTTCAACAAGAACCTG
AACGAGGACACGACCTTCCTGCCCTTCACGCTCCAGGAGCTAG
gtaggggccgagcagtggggcacgggtggccatcggtcctgggactcagtgcaggcctgc
caggccctcgggggccgccgcttcctcctgtgggcttctgtgctgaagggcggcgggagg
ccgaagtacgtggacctgaccgccctgggctgaggactttcctcaccggaagcgctccag

Exon  5 +      16523      16673   2   Terminal    151    64    Marginal
aggtcgggcactgccaagcttggctgccagccacttgctcagccctcccgtgtctcgggc
agcacatcctaccctcagcttctggcactcaggagagacgacgggctacaatctgccgta
aagcacgtttcccagcctgcccctcagtgggtgcactgatcacccgcaccattcccgcag
CCACCCACGCCATCCCGCGGCCACCCGCACCGTCCCCGCGGCCACCCGCACCATCCCCGT
GGGGCTGCTTCTCCTGCCTGCTCGTGTTAGCAAGCAGAAGGACTCGGTGCCTGATGTTCT
AGAAGCCAATGCCATGGCACCAAGGATTTGA
ggaaacaaaagcttctcattgcaagtgactcccaaggagactgggcgtccagctcaaatc
tgcctcctgtgccagctttcaggcagtactttcatgagagaaggtgcagaggtggattct
gggattagcaggtgattgttggaaggaaaggggaggtctggaaggtccttgggcacgcac

Exon  6 +      17161      17281   1   Internal    121    70        Good
tccagccggtttcagccagttttgttcttgtcggcgtttcagctgcctgtttcttttcac
gtttgccatcctgcaaactcgaatgtttgtggattttggtgtctaactctttggggtgcc
gttccatttgtcgggcctgaggggtctcccgtgcaggtggcttgagtcccatgtggccag
GTGACACCGTCATGCGGGTGGCTAGCGTGTTGGGTGACAGTCTCCAGGGCTGTCCGCTGC
TGCTGCCCCGGGACCTGTTTCCCTTTGTGGTCCGTCATTTCTCAGGAGACGCCTTGCGAT
G
gtcttagttccttttcttctgcttacaacagaaaacctaaggccatgtagtttataagaa
aaggaattaacttgtcacagctctggaggctgagaagtcccaggtcgaggggccatatct
ggccagggccttcttcctggtggggactctggagccctgaggcggccagggtgtcacatg

Exon  7 +      20659      20869   2   Internal    211   100   Excellent
gagaaacgtggcaggtggtggccaggctgtgggggagccagggtatttcttgatggggtt
agatgggggatgtaagaattgcagcgggtggtggccaggctgcagctgctcgctgagggc
ccccttgtagctttccaggcagaggggaagcccaccccttccctcacacgctgtgtgcag
GCTGTGGGCCCATCAGTCCTGTCAAAGCCACCCTGGTTCTGTCCCCATAGGAGGGCTCCC
CGAGGACTTTCTGAACTCCCTGGAGAAGATGGAGGACGGCAAGTTGAAGGTCACCCTCAA
GTACCCCCATTACTTCCCCCTCCTGAAGAAATGCCACGTGCCTGAGACCAGGAGGAAAGT
GGAGGAGGCCTTCAACTGCCGGTGCAAGGAG
gtgagaaggcacggccagggggccccagaacagtgggtctggagcttgtggggcccgtct
gctccatgtgtgtgaggcacctccaggctttgcacttggatggcctcccaatctccctgg
ccaggcccagtggccagcagaggcctccctgtggggctctgccgtgccctggaggtgtct

Exon  8 +      22520      22745   0    Initial    226    53    Marginal
ggctcctcggacagcccctggtccccataccacgttccgtgtgaggccttagagtcatct
gcaccccttctggttccaaaaaggccttgggattatgataacgctggtggcatgaccaga
ggagttgtgtagtaacacaggccgagaggggcagggaccggaggtcagacggagctggat
ATGAGCCTTTGGCCCTGGGACAGGGCGTGCTGGCCCTGGAGGTGGAGGGAGTGGCGCCCC
TGGGTGACAGTGTGGTGGTGTCGGTTGCAGGAGAACTGCGCTATCCTCAAGGAGCTGGTG
ACGCTGCGGGCCCAGAAGTCCCGCCTGCTGGGGTTCCACACGCACGCCGACTATGTCCTG
GAGATGAACATGGCCAAGACCAGCCAGACCGTGGCCACCTTCCTAG
gtagcccttccttcctcctccactggggtccctgtggggaaggttctcagggtcacccca
ggggacagtcggtgctacccctagagccttgtcctttccctccatgaagagggacttctg
acgcctgccctggctccctcactccccccgagggacccttacagaacagggaagcgcccg

Exon  9 +      23135      23492   1   Internal    358    87        Good
cggccccgccgccccctcaccctgagcgtgaggatgctcggcccctcgaggggttgccgg
gaactgcgggtcctcccttccaaatggggagcctgacgaagtcgcggccgcgggcgggcg
agcccagagccatggaggagcccgcgaggcgagaggcccacctttctgccctccccgcag
ATGAGCTGGCGCAGAAGCTGAAGCCCCTGGGGGAGCAGGAGCGTGCGGTGATTCTGGAGC
TGAAGCGTGCGGAGTGCGAGCGCCGGGGCCTGCCCTTCGACGGCCGCATCCGTGCCTGGG
ACATGCGCTACTACATGAACCAGGTGGAGGAGACGCGCTACTGCGTGGACCAGAACCTGC
TCAAGGAGTACTTCCCCGTGCAGGTGGTCACGCACGGGCTGCTGGGCATCTACCAGGAGC
TCCTGGGGCTGGCCTTCCACCACGAGGAGGGCGCCAGTGCCTGGCATGAGGACGTGCGGC
TCTACACCGCGAGGGACGCGGCCTCGGGGGAGGTGGTCGGCAAGTTCTACCTGGACCT
gtacccgcggtgggtgagggcagcgggggcggggggcgcaccccggccctgggtctcctc
ggagcccggtgtgcccgtctgagatgggaaggaagtcgttgcctgctccatggggcctcg
gggatgaaccccgagacgtagcacccgtgggcacaccacaggggccgaaaatgcagctgt

Exon 10 +      23936      24137   2   Internal    202   100   Excellent
gggcctggccgtggttttcatgctgccctgcgccaagccacctctgctgagagggaggtt
tagaacctcagaggtgcccggcggtctgggttagcagtcaggtgggctgagggatgcgga
gtcagggactcttgcggtgtctctagtccctgcggggcctgacgctgcctccctccccag
GGAAGGAAAGTACGGGCACGCGGCCTGCTTTGGCCTGCAGCCCGGCTGCCTGCGGCAGGA
TGGGAGCCGCCAGATCGCCATCGCGGCCATGGTGGCCAACTTCACCAAGCCCACAGCCGA
CGCGCCCTCGCTGCTGCAGCATGACGAGGTGGAGACCTACTTCCATGAGTTTGGCCACGT
GATGCACCAGCTCTGCTCCCAG
gtgggtgcgggcccgggcaggggcaggggcaggggcaggggcaggggctgcctgtggtca
gcgaggcccaagcctggggcttcggcttccggctctctctgcacccgtccggtggctcct
tcatccaatgccacccaaagatggtgactccctgtcatgcccgtgtcctggggctgcccc

Exon 11 +      25997      26183   0   Internal    187   100   Excellent
agcagcagcccaggggcctccgggtcccggtcgttttccagttttggggtgggagggccg
ggcccagcgcatcacctgtgcactcgccctgtttgcactgtggcagctgacacgggccag
gccggcgggaacgggctaggcaggacctgggcactctgaggctctgccccatccctgcag
GCGGAGTTCGCCATGTTCAGCGGGACCCACGTGGAGCGGGACTTTGTGGAGGCGCCGTCG
CAGATGCTGGAGAACTGGGTGTGGGAGCAGGAGCCGCTGCTGCGGATGTCGCGGCACTAC
CGCACAGGCAGCGCCGTGCCCCGGGAGCTCCTGGAGAAGCTCATTGAGTCCCGGCAGGCC
AACACAG
gtgcacccgccccgtccggggaagggtgctaacctcggggggcggcacacagctggggcc
tggcatgtgccccgggtgggggtcggagctctgggcagagtgggccggggcaggtgcaga
ggccagctctctccttccctcccgcccaggcctcttcaacctgcgccagatcgtcctcgc

Exon 12 +      26333      26461   1   Internal    129    97   Excellent
aagctcattgagtcccggcaggccaacacaggtgcacccgccccgtccggggaagggtgc
taacctcggggggcggcacacagctggggcctggcatgtgccccgggtgggggtcggagc
tctgggcagagtgggccggggcaggtgcagaggccagctctctccttccctcccgcccag
GCCTCTTCAACCTGCGCCAGATCGTCCTCGCCAAGGTGGACCAGGCCCTGCACACGCAGA
CGGACGCAGACCCCGCCGAGGAGTATGCGCGGCTCTGCCAGGAGATCCTCGGGGTCCCGG
CCACGCCAG
gtagccacccttgagccgggcacaccctggaatttggagcctcagctgcttccctgggaa
ggtgaagggagttggtccccatgcttcacttagcaagtgcaggagtccctgctggggagc
cacggagcgcgtcccaggctcctcgggggacagccccagctgagatgcagctgcaggccc

Exon 13 +      27291      27427   1   Internal    137   100   Excellent
ccctcgctttgtggctgactctggttctagaagtatccagctggtctcggccctcaccgt
gatcctccagcttctccctgttccgggcaggggtctcaggagtctggctggttgtcttct
cctggaggaggagcatggggtgggggctacagcgtgaaccctgccatgtgtccgccccag
GAACCAACATGCCTGCAACCTTCGGCCATCTGGCAGGTGGCTACGACGCCCAGTACTACG
GGTACCTGTGGAGCGAGGTGTATTCCATGGACATGTTCCACACGCGCTTCAAGCAGGAGG
GTGTCCTGAACAGCAAG
gtacgcggggactggggacagggagggcgtcctgaacggcaaggtacgcggggactgggg
acagggagggcgtcctgaatggcaaggtacgcggggactggggacagggagggcgtcctg
aacggcaaggtacgcggggactggggacagggagggcgtcctcaacagcagggtggggcc

Exon 14 +      28808      28969   0   Terminal    162    96   Excellent
ttctgatgaaaggcacctgcgctctcccacctgtgctgatgcaggcggcccccgggcctc
cctgggaacctggaaggggttgctccgaggcccccctgggcgagggtgtgcagactcctg
gggtcctctgccttcctccctgggtccccacccggccacagtgccctgtctcctcggcag
GTTGGCATGGATTACAGAAGCTGCATCCTGAGACCCGGCGGTTCCGAGGATGCCAGCGCC
ATGCTGAGGCGCTTCCTGGGCCGTGACCCCAAGCAGGACGCCTTCCTCCTGAGCAAGGGG
CTGCAGGTCGGGGGCTGCGAGCCCGAGCCGCAGGTCTGCTGA
ggcctggcactgcgactgcccagtctggcctgcgctcccgccgccctggtgccttagccc
ccggcacaggatggggcaggctctggcacagtgcctgggactggcagggtggctgagcgg
ctgtcttgcctcttgtcattgtctgtccccacccggtcgtggcccacccggctagagacg

--------------------------------------------------------------------------------