--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (8896 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (4 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1235       1331   0    Initial     97    86        Good
gagtgcagcacggttgtgggggcagatactgactatgagagcgttggaggttattctcgc
gagatcggatctgggctccgcgaggttttggcgtagttgtgggactgcgcaggcgccgtt
tggagcccttacgctcacacttctctcccgcgcaggcgcagacggggaagcggagccaac
ATGCCAGTGGCCCGGAGCTGGGTTTGTCGCAAAACTTATGTGACCCCGCGGAGACCCTTC
GAGAAATCTCGTCTCGACCAAGAGCTGAAGCTGATCG
gtgagtggccaaggcttccgggaagtggttcggcttccgggaggcggttagcacgtggat
gaaggtgcccatgtactctatctagtccgtcccctaaatttggtactattcgtggtttag
gaaggttttgtgattccaaagctgccagtctagttgttgtgccagtacgtgggactacac

Exon  2 +       1537       1659   1   Internal    123   100   Excellent
tggttcggcttccgggaggcggttagcacgtggatgaaggtgcccatgtactctatctag
tccgtcccctaaatttggtactattcgtggtttaggaaggttttgtgattccaaagctgc
cagtctagttgttgtgccagtacgtgggactacacttgtccacccccttctccccaccag
GCGAGTATGGGCTCCGGAACAAACGTGAGGTCTGGAGGGTCAAATTTACCCTGGCCAAGA
TCCGCAAGGCCGCCCGGGAACTGCTGACGCTTGATGAGAAGGACCCACGGCGTCTGTTCG
AAG
gtgcgtatgggagtccacagcagagggatggggtgcagggcttgtgaggttcattctccc
ttctgttgcctctgttccagtgatgagagttgtgtcattggataaatggaaccagccttc
taacttttagtggcacttgtgaagtaggaaaagtgtatctggatcagtctttgccctgtt

Exon  3 +       6326       6512   1   Internal    187   100   Excellent
gtgagccaccactcccagcccgtagggtggttttgacagtgacatgggtcacggtgatgg
cgctgtactacttgtgcctcaccgccgcggcatggagctaccaagaggcggagccaggat
ttgaacccaagaagcctgaggtcagaaggcggaatcagtgtttcctcccactcttcccag
GCAACGCCCTGCTGCGGCGGCTGGTCCGCATTGGGGTGCTGGATGAGGGCAAGATGAAGC
TGGATTACATCCTGGGCCTGAAGATAGAGGATTTCTTAGAGAGACGCCTGCAGACCCAGG
TCTTCAAGCTGGGCTTGGCCAAGTCCATCCACCACGCTCGCGTGCTGATCCGCCAGCGCC
ATATCAG
gtaccacctcggatgggcacctgaatcttcctccacctgcccctctgatggttgccctca
ctaagcctgctgtccctatctcctatgcagccctcggaggtgatgggtgtgaactcaccc
agagggtacagattcacccttgcacacagctcaccagggagctggggcagcctcttgccc

Exon  4 +       7448       7625   2   Terminal    178   100   Excellent
taaggtgataccctaaaaccccggagggcgcacgtaggatcaggtgcacccttcctgcag
cgccttggtgtctgcagccgtggcggcctcacggggtgggtggagaggaaagagtggtgc
ggtagctggggttagcgtccgtttctcctccagtccacctcaccttgtcgcttcttccag
GGTCCGCAAGCAGGTGGTGAACATCCCGTCCTTCATTGTCCGCCTGGATTCCCAGAAGCA
CATCGACTTCTCTCTGCGCTCTCCCTACGGGGGTGGCCGCCCGGGCCGCGTGAAGAGGAA
GAATGCCAAGAAGGGCCAGGGTGGGGCTGGGGCTGGAGACGACGAGGAGGAGGATTAA
gtccacctgtccctcctgggctgctggattgtctcgttttcctgccaaataaacaggatc
agcgctttacaattggtgtgtgggggtctctcatccttgactctttcccctgctctaaac
atgcagccttccctgggaggctcactcacttgggagtgcctaccagctagtggtccctgg

--------------------------------------------------------------------------------