--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (10201 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1310       1381   0    Initial     72    94   Excellent
catgcccacaaaggccaaggagggagtgcgcaggtcacgtgcgccggtggtcagcgcgcg
cattgcctgccccggaagtggtcggcgcgcggcgcggcgcgcctgggcgctaagatggcg
gcggcgtgagttgcatgttgtgtgaggatcccggggccgccgcgtcgctcgggccccgcc
ATGGCCGTCACCATCACGCTCAAAACGCTGCAGCAGCAGACCTTCAAGATCCGCATGGAG
CCTGACGAGACG
gtgcgggccgggccggagcccgggggcgggagcgacgggtttcgggggtggggtgggggc
ggggaggctagaatcccaacgggaggggcagggaggacggcgcgggtcggccctgcccag
acccccgacctgcccgactttcctggaccccccgatggtctttggcccagcccccagccg

Exon  2 +       3209       3374   0   Internal    166   100   Excellent
gtgttgaatggcatgatgattgaatgaattcaaatctagcatgctttagatgctgagaaa
gcttaaaaaacccagcgtgcttgcctttctgccatcagggctggcagtttctctgtccta
aactagaagggaaaagagaatcttggggtctccagtgactgtctgtaccactccctctag
GTGAAGGTGCTAAAGGAGAAGATAGAAGCTGAGAAGGGTCGTGATGCCTTCCCCGTGGCT
GGACAGAAACTCATCTATGCCGGCAAGATCTTGAGTGACGATGTCCCTATCAGGGACTAT
CGCATCGATGAGAAGAACTTTGTGGTCGTCATGGTGACCAAGGTGG
gtgacgtgtgctggctgggagggtgggtggacgagctggggagctggcaaagagcctgtg
tgcccaggagagattagctgtgaacagggcggggccacagcggagcgggttgttgggtct
gatagggttgctgatgccagctccctttttcttgctgttgcagaccaaagccggccaggg

Exon  3 +       3875       3913   1   Internal     39    65    Marginal
cgacgtccccagagtctgtgtcagggtaaggcgggggcagcagtcccagcttgggccctg
tcctcctagcacattccagcgtccacataagtggtcccacacacctggagggagggcaag
ccgccagaagccagggtccgatttctctctcttgaatttgcagctctgttccctcttcag
GTAGCAGCGGGCGAGAGGAAGACGCGGCCTCCACGCTAG
gtgggtgggtggtccccagggcagaggtgactgggtgccccagccatcagctgggccttg
tctgggtgcgggagggcctgggagctgccctttcctcttcctggtgacctaggctttgct
gcttcctccacagtgacgggctctgagtatgagacgatgctgacggagatcatgtccatg

Exon  4 +       4026       4179   1   Internal    154   100   Excellent
ttgaatttgcagctctgttccctcttcaggtagcagcgggcgagaggaagacgcggcctc
cacgctaggtgggtgggtggtccccagggcagaggtgactgggtgccccagccatcagct
gggccttgtctgggtgcgggagggcctgggagctgccctttcctcttcctggtgacctag
GCTTTGCTGCTTCCTCCACAGTGACGGGCTCTGAGTATGAGACGATGCTGACGGAGATCA
TGTCCATGGGCTATGAGCGAGAGCGGGTCGTGGCCGCCCTGAGAGCCAGCTACAACAACC
CCCACCGAGCCGTGGAGTATCTGCTCACGGTGAG
gtggggcttccgcctcccggggaggccttgagggagtacccgggcgtcactgccctgatg
ggcggttgggaaggcaaaacctgccctgaaaagcctttgggtagtgattctagccactaa
aggcttcccacaggaggctggatgtgagtgatgggtgggcctctggagggcagggccgag

Exon  5 +       4636       4769   1   Internal    134   100   Excellent
ccccgagccggaacacggttctgtccaggagagccaggtatcggagcagccggccacgga
agcaggtgggtgtgcacatgccgcatctgccctccaggtacctgactcacattacactcc
accccgcagtgctcctaggagcccggcgtggtgtctgactgcaccccttcctactaccag
CAGGAGAGAACCCCCTGGAGTTCCTGCGGGACCAGCCCCAGTTCCAGAACATGCGGCAGG
TGATTCAGCAGAACCCTGCGCTGCTGCCCGCCCTGCTCCAGCAGCTGGGCCAGGAGAACC
CTCAGCTTTTACAG
gtgtggtcccaagggcagagggagctagggcagccaccatttcccttccctgtgggcacc
agagtccataacacgtaggaatcgttctaggtccggaaagcaggactaagcacatgcttc
ccccacgcccctgtgcttcctgtgacctggtgacccccctggtttctcagtcttcccaac

Exon  6 +       8050       8214   0   Internal    165   100   Excellent
aaaagcacatcatcagctcttccagggtagggcttgtgtcgactgctatgttgtgtttgg
ccagaacaggctcctctggatatttgcctgactgaatgaaaaagcaagggctgtgatgac
ctggggagaggaggggaccagggctgtgaattaccttcccttccccaccctctcctgcag
CAAATCAGCCGGCACCAGGAGCAGTTCATCCAGATGCTGAACGAGCCCCCTGGGGAGCTG
GCGGACATCTCAGATGTGGAGGGGGAGGTGGGCGCCATAGGAGAGGAGGCCCCGCAGATG
AACTACATCCAGGTGACGCCGCAGGAGAAAGAAGCTATAGAGAGG
gtaagaggcctggctgaggggtgactgcaggtgggcaggacccctaccctctcctgctca
cacttaacctatcttcccacagttgaaggccctgggcttcccagagagcctggtcatcca
ggcctatttcgcgtgtgaaaaaaatgagaacttggctgccaacttcctcctgagtcagaa

Exon  7 +       8297       8410   0   Terminal    114    96   Excellent
tctcagatgtggagggggaggtgggcgccataggagaggaggccccgcagatgaactaca
tccaggtgacgccgcaggagaaagaagctatagagagggtaagaggcctggctgaggggt
gactgcaggtgggcaggacccctaccctctcctgctcacacttaacctatcttcccacag
TTGAAGGCCCTGGGCTTCCCAGAGAGCCTGGTCATCCAGGCCTATTTCGCGTGTGAAAAA
AATGAGAACTTGGCTGCCAACTTCCTCCTGAGTCAGAACTTTGATGACGAGTGA
tgccaggaagccaggccaccgaagcccccaccctacccttattccatgaaagttttataa
aagaaaaaatatatatatattcatgtttatttaagaaatggaaaaaaaaatcaaaaatct
taaaaaaacaagcaaacagtccagcttcctgtcctcctaaagtggcccctgttcccatct

--------------------------------------------------------------------------------