--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (82418 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (35 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1449       1539   0    Initial     91    85        Good
ctccatgtgaccctccctctgcctcctccatgaaggtctcctggatttccccactcgcct
ctcacagccctccattgtctctgcagacgttgccccatctgacgctcggctcgaggcctc
tctgtgagggaccggggggccatccccctccagggcggagatcggaggtcgctgccaagc
ATGGCGCCCACCTGGGGCCCTGGCATGGTGTCTGTGGTTGGTCCCATGGGCCTCCTTGTG
GTCCTGCTCGTTGGAGGCTGTGCAGCAGAAG
gtaagaagccggcacgggatgtgcaggggtctgcgtgtttgtttacctgtgtgcatttat
ggctgtgtgtgtgtgggcacactccccacctcctccctggggccctccattttgccaaat
ggaacttttatgctccacaaatgaggctgaatgctgaggactgtgtgctgagccctaaga

Exon  2 +      13245      13390   1   Internal    146   100   Excellent
gtggtggggggcgaggtgggagggtgtttgttgtcatccttgctttcctcctcctctctt
cattggccacatggcacttccgtgggcagggcatggaatgcaggttttcgtggctccttg
gtatcctagccagatgcctggacccatcagcgcccccccttctttccactgtatccccag
AGCCCCCCAGGTTTATCAAAGAACCCAAGGACCAGATCGGCGTGTCGGGGGGTGTGGCCT
CTTTCGTGTGTCAGGCCACGGGTGACCCCAAGCCACGAGTGACCTGGAACAAGAAGGGCA
AGAAGGTCAACTCTCAGCGCTTTGAG
gtgagttggggtagggggaggcagcctggggtcaatgctcccccaaggcagggccacagc
acctcagccacagtggacttcgtggacacgttccccaggtggagcatcatctgtggccaa
gcaagcatggctgcgcagcctccagccagggccctgcccgccttacttgctctaccagct

Exon  3 +      14006      14147   0   Internal    142    93   Excellent
cggcgcatttatactggacaccgacacacgtgcacattcagcctgcagcaattctcccag
tcacccccaggatcatggggctgactgccattcccctacagcccagcctagcccagccta
gacaggaaccttcctgggaccccagcctcactctgttcttttttcccctgcccatggcag
ACGATTGAGTTTGATGAGAGTGCAGGGGCAGTGCTGAGGATCCAGCCGCTGAGGACACCG
CGGGATGAAAACGTGTACGAGTGTGTGGCCCAGAACTCGGTTGGGGAGATCACAGTCCAT
GCCAAGCTTACTGTCCTCCGAG
gtattgggctcctcagggcgggcggaggataaactgggccctgggctttggggacaagca
caaaaggaatacatgaaagttaccccaaaccctcctgctttgtgttttttgggaggacct
tgatctcccttatccaaccagtaacagtctcagggcccagcgcctactggtggggattta

Exon  4 +      22393      22581   1   Internal    189   100   Excellent
gagcaagaccctgtctcaaaaaaagagagagaactggctgtaaaggatggcacccatggc
tgaggtcacgcagccagggaggagctggacccgtggccaggcagtccctgagccccaggc
tcaggagtggctgtgcagtgctcagaaccatgcccatttctctcacgtctctgccctcag
AGGACCAGCTGCCCTCTGGCTTCCCCAACATCGACATGGGCCCACAGTTGAAGGTGGTGG
AGCGGACACGGACAGCCACCATGCTCTGTGCAGCCAGCGGCAACCCTGACCCTGAGATCA
CCTGGTTCAAGGACTTCCTGCCTGTGGATCCTAGTGCCAGCAATGGACGCATCAAACAGC
TGCGATCAG
gtgagtgagggtggctgacaggacgtgggagccttggagggcagcagggggtggggagca
tctccagggcccaagttctggggactactggaggacagacagagacagtgtgtggccgtg
gcaggcgttggctctgggggagtgggggcaaatgtcttcaaagccgcacactgaggatat

Exon  5 +      29462      29572   1   Internal    111   100   Excellent
ggggtggaggttatacaaggcctggccaagctagggcttccaggttttctcacctcttat
ctgcctctctggcccagccagcacaggagacaggccagagagcactctggtgggggagct
ttccctgttcactcctgggcccccctctaacagaccaagctttttcccatcttcccacag
GAGCCCTGCAGATTGAAAGCAGTGAGGAAACCGACCAGGGCAAATATGAGTGTGTGGCCA
CCAACAGCGCCGGCGTGCGCTACTCCTCACCTGCCAACCTCTACGTGCGAG
gtagggaacgccgcgtccaggtcaaaggcagggacccgccccgtcccatccccctccctc
ctcgggctcaccgcctccgggctcccccgtcccctgcacacccaagcaggaaggcccctc
cccggtcgcggtgggaccttggccgaggcggcgtccctctctgggccttagtttccttgc

Exon  6 +      31770      31832   0    Initial     63    59    Marginal
acacacacggaaaaaaaatagaaaaatgaacaacaattttaaaagatggaatatgaatca
taagcacaaagcaaactaaacaaaaaaccgccaagcgagcgcaaaacccagaaagacacg
aaaatctcagccgcgcccagcccggcctagggccggccgcacacatgcgatgcttgcatt
ATGGTCGCCTCTGCATCCGTTGGTAATGTTGTTGCTAAGTTTTTTGCACTCCTCGTCGTC
ATG
gtaacttgggcctgatgcatgctgggagaatgtaaaaatttctctgcatgcctctcttgt
cggtttggtttggtgaattcccaacgccttctgttggagtgtttctcgtcttctgttctg
tttttctcttttggttttcttttttcctttttcttttttttttcttttttctttttttct

Exon  7 +      41544      41813   1   Internal    270    99   Excellent
gaaccagccctgtttatatttaaatggttttcctttttttttctttttttctttctttcc
ttctttctttcttccttcctgcttttctttttctcctccgcatcctgtcttcccctccca
acctcaccccacctcacccctcgcatctccctcccgccgccactgccgccccctccccag
TCCGCCGCGTGGCCCCGCGCTTCTCCATCCTGCCCATGAGCCACGAGATCATGCCAGGGG
GCAACGTGAACATCACCTGCGTGGCCGTGGGCTCGCCCATGCCATACGTGAAGTGGATGC
AGGGGGCCGAGGACCTGACCCCCGAGGATGACATGCCCGTGGGTCGGAACGTGCTGGAAC
TCACAGATGTCAAGGACTCGGCCAACTACACCTGCGTGGCCATGTCCAGCCTGGGCGTCA
TTGAGGCGGTTGCTCAGATCACGGTGAAAT
gtgagcagggcccatggggctcgtaggtggaggggcaggctggagtcgatccccgacttc
aggcacaggtgggaggcagcgtgggagcacctccgagttaccctcttggcttcagtcatt
catggctaggaaggggacggttgttctttgaacaggtattatttattggttataaatgat

Exon  8 +      43107      43688   1   Internal    582    90   Excellent
ggaccctgggccatagtttgttaccccttgctgtagacgatgacaggagtcatgaggccc
atgattactgctgggcaaatcaaggctcagagaaggcgactgaatggtgaaaagtcacac
agccttcagggtcctcaaccaatgtgcccaatgcgtgacacagctgcctcctgcccacag
CTCTCCCCAAAGCTCCCGGGACTCCCATGGTGACTGAGAACACAGCCACCAGCATCACCA
TCACGTGGGACTCGGGCAACCCAGATCCTGTGTCCTATTACGTCATCGAATATAAATCCA
AGAGCCAAGACGGGCCGTATCAGATTAAAGAGGACATCACCACCACACGTTACAGCATCG
GCGGCCTGAGCCCCAACTCGGAGTACGAGATCTGGGTGTCGGCCGTCAACTCCATCGGCC
AGGGGCCCCCCAGCGAGTCCGTGGTCACCCGCACAGGCGAGCAGGCCCCGGCCAGCGCGC
CGCGGAACGTGCAAGCCCGGATGCTCAGCGCGACCACCATGATTGTGCAGTGGGAGGAGC
CGGTGGAGCCCAACGGCCTGATCCGCGGCTACCGCGTCTACTACACCATGGAACCGGAGC
ACCCCGTGGGCAACTGGCAGAAGCACAACGTGGACGACAGCCTGCTGACCACCGTGGGCA
GCCTGCTGGAGGACGAGACCTACACCGTGCGGGTGCTCGCCTTCACCTCCGTCGGCGACG
GGCCCCTCTCGGACCCCATCCAGGTCAAGACGCAGCAGGGAG
gtgaggcgtggggtcggcaggactcggggccccggccgtgcggcttggttctttgcatgc
tccctggaagccgcagagcggtttgtgggttatgcacggtgctttaagatattttcatgc
tagcatttaggccgggtgtggtggtttacgcctgtaatctcagtactttgggaggccaag

Exon  9 +      47257      47390   1   Internal    134   100   Excellent
ggatggaggaacagaggtggacaggtgacaatgggatgggggcgaggtccccaggaaaat
aaaagaacattctagaagcacccagagctggcatcttttagtggggacactcagcaggtg
gggccccctttgtggggtggacgctccccgactcctagttgtctccctgcacccccacag
TGCCGGGCCAGCCCATGAACCTGCGGGCCGAGGCCAGGTCGGAGACCAGCATCACGCTGT
CCTGGAGCCCCCCGCGGCAGGAGAGTATCATCAAGTACGAGCTCCTCTTCCGGGAAGGCG
ACCATGGCCGGGAG
gtgaggcagcgcggggacgggctggcctgccctgggctcctccccggcgctctctgacgc
tgcccgccttgtctcttccccctctttgtccctatgtgtgctgcggattctgctcttcct
caccccttctgcttctcctgcgtctctgtccctttgtgcctttcctccacttttttctcc

Exon 10 +      48526      48674   0   Internal    149   100   Excellent
ctctccctcatccctctctgtccctctctgccgcacccctgtctctatttctctgtctct
ctctctctctctctctctccccctcccccctctgtttctgtctctctctctctccccttt
gtttctgtctctctctctctctcccccatccctctctgtccttctctgccctgcccccag
GTGGGAAGGACCTTCGACCCGACGACTTCCTACGTGGTGGAGGACCTGAAGCCCAACACG
GAGTACGCCTTCCGCCTGGCGGCCCGCTCGCCGCAGGGCCTGGGCGCCTTCACCCCCGTG
GTGCGGCAGCGCACGCTGCAGTCCAGTAG
gtgtctcgcggggccgcccttctctgcgggagggaccacggcctgaccgcagacagcccc
tcggcagacggacccaggcggggcctgctgcagtgggtggggggcgcctcccggcctgtc
tccgctttgttccccgacctcggatccatctacccgcgctgtgcctcagtatccccatca

Exon 11 +      50105      50147   2   Terminal     43    85        Good
caaaaacggcccaccccgcgtgcccccccgcctgccccagccactctgggctgaacggac
agtccacggcccgaattcggccccagaaactctcccaaaccacgtgccaccaccatgcca
cgctgcccacgcacgcacatccacgtctttgcacacatcccttcccgagatgtcatgcag
GTTGGGCCGGATTGTGAAGGACGTGACCTACACGGTCACCTAG
aaagcggcttcggcccagccacgcgaacctccggggcggcccaggacagggagttgggga
gaagggactccccgcttcttgccccgagacgggtggggcccaggagaaccgacagcaaag
actcagggccaggcgtatccatccccccggggactgcgggctccttaggctgaacacagg

Exon 12 +      55974      56279   1   Internal    306    89        Good
catcccacctttggttgacacccacttcttttgggttcgacttctctttggtttggttct
gttttgtttgttatcatcttcttttttattttctctttcccatcttttgtttccccgccc
ccctccccacccatcccacctcccttccccacccccccacgttctccccccctccaatag
AACCGTCAGCCCCCCCTCAAGACGTTAAATGTGTCAGCGTGCGCTCCACGGCCATTTTGG
TAAGTTGGCGCCCGCCGCCGCCGGAAACGCACAACGGGGCCCTGGTGGGCTACAGCGTCC
GCTACCGACCGCTGGGCTCAGAGGACCCGGAACCCAAGGAGGTGAACGGCATCCCCCCGA
CCACCACTCAGATCCTGCTGGAGGCCTTGGAGAAGTGGACCCAGTACCGCATCACGACTG
TCGCTCACACAGAGGTGGGACCAGGGCCCGAGAGCTCGCCCGTGGTCGTCCGCACCGACG
AGGATG
gtaagtacctgccccaggcccgggaccccccgcaggccccagcccggcccccgcctcgaa
gccttccatctggaaacctgggctggtggtcaaagggcggaagcctcactcggaggaagt
cgggaagcaagcagcctccccgagaaatccggggctccttgactttggaattggcgattc

Exon 13 +      56518      56635   1   Internal    118    83        Good
aagccttccatctggaaacctgggctggtggtcaaagggcggaagcctcactcggaggaa
gtcgggaagcaagcagcctccccgagaaatccggggctccttgactttggaattggcgat
tctagacatgggcaggcttagctctgcagcatctgctcccagagcctcgtgcctggacag
TTTCGCTGGCTGCCCTCTATTTTGGTGGAACAGTGGAAACCTTTGGAAATGGGGTGGAGG
AAGTGGCAAATAGCACCTGCAACAACAATGTGCTGATCATGGTTAACCAGCTCCCCGG
gtggatggagaccagtttgtgtagcattggccaatttccatggtgtaaatgttcccgtcc
tcacccatttcaagttagcagcaagtttgaagctggaaagcaaggcagtggtcctagctt
ggagtcacgtggtcgaagcctagatcatggagagaaatgacagacacctttcccaataaa

Exon 14 +      57912      58098   2   Internal    187   100   Excellent
ggggggtgtgcaggaggccatgtcctcccgcccggtggtgagcgctaagagcgcccagtt
attcaccggcagccactcggcatcctggaatcggacagtggcactgcccggggcagggcc
gggcgccctggtaacggctccgcccgcccctcccctcccctcccgcccgccagtgcccag
CGCGCCGCCGCGGAAGGTGGAGGCGGAGGCGCTCAACGCCACGGCCATCCGCGTGCTGTG
GCGCTCGCCCGCGCCCGGCCGGCAGCACGGCCAGATCCGCGGCTACCAGGTCCACTACGT
GCGCATGGAGGGCGCCGAGGCCCGCGGGCCGCCGCGCATCAAGGACGTCATGCTGGCCGA
TGCCCAG
gtgggcggggggccggggcggggccggggacgggctccgggcggggacgggcccttgcgc
tccccccacctctgcttctctttctccatctctggcctcccccgctcaccttcctcctct
ctcccctgccgcctcctcccgcgctcagtgggagacggatgacacggccgaatatgtaag

Exon 15 +      61299      61380   0   Internal     82    57    Marginal
gcgtcagccactgcgcccagcctcgtacagtttaatttttaataacagctctgtttcata
agtggctcacaaaattcctgaaaatttaaccagcggctctcatgagttggtaccgggcac
ctccagcacaccagtgggtgtagacaggggggaaggccagtgccaaagggcctgaggcag
GCTGTGCCTGGTGCATTGGAGGAACAGCAAGGAGAGCCCTTTGTGAGCCACAGGGAAGAC
TTGGGCTTTGACCCCAAGAGAG
gtgggagccatggagggctgtggggagagcggggacggaccctgactccagtgctcacag
gcgccctctggctgctgtggggaggacagactgtcgggggtgatggcaaggagtgagggg
agcggagcagagaggaccgagttggtcctggcaagcgacaatgggctcgtccggctgggt

Exon 16 +      61674      61862   1   Internal    189    90   Excellent
tgaggggagcggagcagagaggaccgagttggtcctggcaagcgacaatgggctcgtccg
gctgggttgttgcatgtaccctctgagcatggccatgccacgtgtcgtggtctctgcatg
agctcatgtgcacgtctccacccctgatccgggccctgcatcctccttgcttgttctcag
CACGGGGAGTGGGGGTGGGTGGGGCTGCTCCCAGCCCCAGCCGTCGTGCTGACCCCCAGC
CGTGCCTGCAGGAGATGGTCATCACAAACTTGCAGCCTGAGACCGCGTACTCCATCACGG
TAGCCGCCTACACCATGAAGGGCGATGGCGCTCGCAGCAAACCCAAGGTGGTTGTGACCA
AGGGAGCAG
gtatgcaacccgccctcctcccacccaccaacagcccctttgcccccactggcaccagag
cgtgactccagagtccttgagctcacaagggcaggcagagggtgcaccaggcagctggaa
cagtgagacaaaggtgtgagggctgctcaggtgggtgtccagggcccagcttggcccccc

Exon 17 +      64292      64900   1   Internal    609    86        Good
tcgaggctgcagtgagccgtgatctcaccattgcactccaggctgggcaacagagtaaga
ccccccccaactcaaaaaaatgttatattgaaggaaaagaattaaaaatacaaccccacc
ttgtgcctctgggctggcggatggcgctgggaccctgacacctgccccgtatccccgcag
TGCTGGGCCGCCCAACCCTGTCGGTGCAGCAGACCCCCGAGGGCAGCCTGCTGGCACGCT
GGGAGCCCCCGGCTGGCACCGCGGAGGACCAGGTGCTGGGCTACCGCCTGCAGTTTGGCC
GTGAGGACTCGACGCCCCTGGCCACCCTGGAGTTCCCGCCCTCCGAGGACCGCTACACGG
CATCAGGCGTGCACAAGGGGGCCACGTATGTGTTCCGGCTTGCGGCCCGGAGCCGCGGCG
GCCTGGGCGAGGAGGCAGCCGAGGTCCTGAGCATCCCGGAGGACACGCCCCGTGGCCACC
CGCAGATTCTGGAGGCGGCCGGCAACGCCTCGGCCGGGACCGTCCTTCTCCGCTGGCTGC
CACCCGTGCCCGCCGAGCGCAACGGGGCCATCGTCAAATACACGGTGGCCGTGCGGGAGG
CCGGTGCCCTGGGCCCTGCCCGAGAGACTGAGCTGCCGGCAGCGGCTGAGCCGGGCGCGG
AGAACGCGCTCACGCTGCAGGGCCTGAAGCCCGACACGGCCTATGACCTCCAAGTGCGAG
CCCACACGCGCCGGGGCCCTGGCCCCTTCAGCCCCCCCGTCCGCTACCGGACGTTCCTGC
GGGACCAAG
gtaggcgcgcggcgacccctgcaccagagccggaccgggccttgcgcccacccccacccc
agccccctccctctcccctgcccaggtaagtgctcacttttctgcttcctcgtggtcact
caaggcaagtccggaccccgaggctccggcgttggcaaaggtgggacgtgcctcggtggc

Exon 18 +      64986      65060   1   Internal     75    58    Marginal
cacggcctatgacctccaagtgcgagcccacacgcgccggggccctggccccttcagccc
ccccgtccgctaccggacgttcctgcgggaccaaggtaggcgcgcggcgacccctgcacc
agagccggaccgggccttgcgcccacccccaccccagccccctccctctcccctgcccag
GTAAGTGCTCACTTTTCTGCTTCCTCGTGGTCACTCAAGGCAAGTCCGGACCCCGAGGCT
CCGGCGTTGGCAAAG
gtgggacgtgcctcggtggcaccaccgccccccaccactgccccctccccttgctcccct
cccccctcttcctcctcctccaccttctttctgcagcctctgcacccgtgccgtctcccg
aagcagggacttgggacaggacagggcagggccgggccagggccaggcaggaaggccgtg

Exon 19 +      65369      65466   1   Internal     98   100   Excellent
acttgggacaggacagggcagggccgggccagggccaggcaggaaggccgtgggcatggg
cacagcggacgacagggagcgcctgggccgccccaccccaccccgcttcacgccacccag
tgccaggcactcatggggcctctcttctgctctctccctgctcggccgcctccccggcag
TCTCGCCCAAGAACTTCAAGGTGAAAATGATCATGAAGACATCAGTTCTGCTCAGCTGGG
AGTTCCCTGACAACTACAACTCACCCACACCCTACAAG
gtgcgactgcccagccagcaggcaggcaggcaggcagggtcaggggttgtagttcagcag
ggcttaaggctcagtttggagttggtgtgaagtgagggatcagggctcagtcagagatgg
gtctcagctaggattgaggcttagtcaatactgggaatcagacttggggcccagcctagg

Exon 20 +      67236      67329   2   Internal     94   100   Excellent
ccaaggcctggaggcctgagtcagcaactgtggcgtttgtggatggggcataggggaata
ggctcattgtatgaacagaagggaagactcagagaaacggcttcccccgtttgcccccat
gaagcatcccttggtcatccctatcgacagcccctctgactctttcccatctccctacag
GAGCTATTTCATTGTGATGGTGCCACTGCGCAAGTCTCGTGGAGGCCAATTCCTGACCCC
GCTGGGTAGCCCAGAGGACATGGATCTGGAAGAG
gtgagggcctggggcccaacccgcagggcccagatgcattccagttttcacgtgctctgt
tgctcccagctgagctctgagccacccatgactctgttcccgcagctcatccaggacatc
tcacggctacagaggcgcagcctgcggcactcgcgtcagctggaggtgccccggccctat

Exon 21 +      67399      67650   0   Internal    252    90   Excellent
ttcccatctccctacaggagctatttcattgtgatggtgccactgcgcaagtctcgtgga
ggccaattcctgaccccgctgggtagcccagaggacatggatctggaagaggtgagggcc
tggggcccaacccgcagggcccagatgcattccagttttcacgtgctctgttgctcccag
CTGAGCTCTGAGCCACCCATGACTCTGTTCCCGCAGCTCATCCAGGACATCTCACGGCTA
CAGAGGCGCAGCCTGCGGCACTCGCGTCAGCTGGAGGTGCCCCGGCCCTATATTGCAGCT
CGCTTCTCTGTGCTGCCACCCACGTTCCATCCCGGCGACCAGAAGCAGTATGGCGGCTTC
GATAACCGGGGCCTGGAGCCCGGCCACCGCTATGTCCTCTTCGTGCTTGCCGTGCTTCAG
AAGAGCGAGCCT
gtaagtcctgaatggtgtccgcccacatccagacacacctctgaatgaggcagaccccat
tccccagggccctgacctctgtggtcagtcacaggcagctccctgtggtcagagctgggc
agaggggaagacttgggagcggagggatcctgaaacgaaggtttcttagaggaagagacc

Exon 22 +      68122      68253   0   Internal    132    98   Excellent
agggaatggggagagcaaagattggcagggaccaggtcacataggccaccagggtcaagg
ttctaggaatataggaggatctagagcgggggagaaacgtaggttcatgtttgagaaaga
cccatctggccactacaaggagggtggacactgatggagacccccctcctttccctgcag
ACCTTTGCAGCCAGTCCCTTCTCAGACCCCTTCCAGCTGGATAACCCGGACCCCCAGCCC
ATCGTGGATGGCGAGGAGGGGCTTATCTGGGTGATCGGGCCTGTGCTGGCCGTGGTCTTC
ATAATCTGCATT
gtcattgctatcctgctctacaagaagtaagccccatgtcctccccgacttgacttgaca
gcagggagggcttcctggaaaaggagggaggagttgtctcagagaatcatcactaaaggt
ctctgttgtacacatggggaaaccgaagttcagagaggttaagccacttgatcaaggtca

Exon 23 +      69274      69346   0    Initial     73    48    Marginal
ctgaacaatgccgacctcgcccctcaccaccccaaggaccctgtggaaatgagacgcatt
aacttccagactccaggtatgtacttatccctggtaccagggatgccaccaacaggggag
atagctggggagaagcagtagctgccaccctgggggcccctcattggccccctctgaact
ATGCTTGGTGCAGCCACATTCTGGATTCCCAAATACCTCCAACCCTACATGGATCTGGGC
TTGGAACTCATAG
gttggttctgcttacaaccaagtgaggcttttttttttttaaagttaacatttaaccaat
ggctgctgtcctcttcaggagcctaaagacgatgtttaaaaaatggagaaaacacaaata
aacccctcatttctttgggcagaaagagctattcttctgtttatgtctctggttttaatg

Exon 24 +      71994      72091   1   Internal     98    89        Good
gggtcccagccccttcatgagccaccctgagtcttcccctcctgccaagccccaccccgg
ccatgcccttctaaccacagctcacccatcgcagactcacacgtagatcacccccctccc
ccgagtccccggctggccccccaagtgaccaaccccggcggggtctgctccaccctgtag
GCATGCTTAGCCACCCGCCAATTCCCATCGCAGACATGGCGGAGCACACGGAGCGGCTCA
AGGCCAACGACAGCCTCAAGCTCTCCCAGGAGTATGAG
gtgagcccacccccgcctcccaccctcatcacctcggcctcacaggcacctaccctgaca
cccgcgctctccccttcctctgtagtccatcgaccctggacagcagttcacatgggaaca
ttccaacctggaagtgaacaagccgaagaaccgctatgccaacgtcatcgcctatgacca

Exon 25 +      72177      72300   0   Internal    124    99   Excellent
tgcttagccacccgccaattcccatcgcagacatggcggagcacacggagcggctcaagg
ccaacgacagcctcaagctctcccaggagtatgaggtgagcccacccccgcctcccaccc
tcatcacctcggcctcacaggcacctaccctgacacccgcgctctccccttcctctgtag
TCCATCGACCCTGGACAGCAGTTCACATGGGAACATTCCAACCTGGAAGTGAACAAGCCG
AAGAACCGCTATGCCAACGTCATCGCCTATGACCACTCCCGTGTCATCCTCCAGCCCATT
GAAG
gtagttcggagatcccgggtcttaacctgcccttccccactgcatggaaagtgctagatc
ccatgtctccccttgggccactgaggcctgattctggtcatagacctggtccagctccaa
ctggaggccactgggcatctttagatatgtatttaactgatggctgctctctctaacatg

Exon 26 +      72853      73028   1   Internal    176   100   Excellent
gcgatctggccccaaatggtgatggcgctgagggggagaaactgtgaagtacacgtccca
tggtcaccttggggacaatctgggagcggtcagagtgaacttccaggaagtggttggcca
cacagagccaaactagcaagacagcccccacagatccctggcctctcgccctggctgcag
GCATCATGGGCAGTGATTACATCAATGCCAACTACGTGGACGGCTACCGGTGTCAGAACG
CGTACATTGCCACGCAGGGGCCGCTGCCTGAGACCTTTGGGGACTTCTGGCGTATGGTGT
GGGAGCAGCGGTCGGCGACCATCGTCATGATGACGCGGCTGGAGGAGAAGTCACGG
gtgagccttggaccccacggccctcaagcccctgccagtcagcctgtccctgctgacacc
tgttctcttgcccgatacagatcaagtgtgatcagtattggcccaacagaggcacggaga
cctacggcttcatccaggtcacgttgctagataccatcgagctggccacattctgcgtca

Exon 27 +      73109      73228   0   Internal    120   100   Excellent
ggggccgctgcctgagacctttggggacttctggcgtatggtgtgggagcagcggtcggc
gaccatcgtcatgatgacgcggctggaggagaagtcacgggtgagccttggaccccacgg
ccctcaagcccctgccagtcagcctgtccctgctgacacctgttctcttgcccgatacag
ATCAAGTGTGATCAGTATTGGCCCAACAGAGGCACGGAGACCTACGGCTTCATCCAGGTC
ACGTTGCTAGATACCATCGAGCTGGCCACATTCTGCGTCAGGACATTCTCTCTGCACAAG

gtggggcccaggctggggctgggggctgagggtggaggaatgtgttggaagggaggcaga
gggccccagcttctacccagggagctccccatgggacagagagaaagcggagcgtgtcta
cccaggctgactacattctcatggaacccacttccgtggagggggaaactgaggctcaga

Exon 28 +      75098      75252   0   Internal    155    94   Excellent
aggtttctccatgttggtcaggctggtctcgaactcctgacctcaggtgatccgcccacc
tcggcctcccaaagtgctgggataacaggcatgagccaccacacccggccacttgggcat
cttcagcacatgggtggcaggttgagccggagtgacaggtgacatccttgtggtccccag
AATGGCTCCAGTGAGAAACGCGAGGTCCGCCAGTTCCAGTTTACGGCGTGGCCGGACCAT
GGCGTGCCCGAATACCCAACGCCCTTCCTGGCTTTCCTGCGGAGAGTCAAGACCTGCAAC
CCGCCAGATGCCGGCCCCATCGTGGTTCACTGCAG
gtacgtccaccccactctgccccatccgcttccccccggtccccgcagcccagcagcccc
tgaacgccacgtggctgtccctgcagtgccggtgtgggccgcacaggctgctttatcgtc
atcgacgccatgcttgagcggatcaagccagagaagacagtcgatgtctatggccacgtg

Exon 29 +      75339      75656   2   Internal    318    99   Excellent
gcgtgcccgaatacccaacgcccttcctggctttcctgcggagagtcaagacctgcaacc
cgccagatgccggccccatcgtggttcactgcaggtacgtccaccccactctgccccatc
cgcttccccccggtccccgcagcccagcagcccctgaacgccacgtggctgtccctgcag
TGCCGGTGTGGGCCGCACAGGCTGCTTTATCGTCATCGACGCCATGCTTGAGCGGATCAA
GCCAGAGAAGACAGTCGATGTCTATGGCCACGTGACGCTCATGAGGTCCCAGCGCAACTA
CATGGTGCAGACGGAGGACCAGTACAGCTTCATCCACGAGGCCCTGCTGGAGGCCGTGGG
CTGTGGCAACACAGAAGTGCCCGCACGCAGCCTCTATGCCTACATCCAGAAGCTGGCCCA
GGTGGAGCCTGGCGAACACGTCACTGGCATGGAACTCGAGTTCAAGGTGCCAGCGGGGTG
GAGGCTGCTGTGGGCGGG
gtggggaggaggcccaaagagccgaaaatcaggcccgcctcgagcaatggggactagaag
gtggtggcagggtgcccctacctacctatccaccattggtgctccagctgaaagcatagc
cttcctcatcctgatggtggcctctggcttcctcctccccacagcggctggctaactcca

Exon 30 +      75862      75999   2   Internal    138    98   Excellent
aaatcaggcccgcctcgagcaatggggactagaaggtggtggcagggtgcccctacctac
ctatccaccattggtgctccagctgaaagcatagccttcctcatcctgatggtggcctct
ggcttcctcctccccacagcggctggctaactccaaggcccacacgtcacgcttcatcag
TGCCAATCTGCCTTGTAACAAGTTCAAGAACCGCCTGGTGAACATCATGCCCTATGAGAG
CACACGGGTCTGTCTGCAACCCATCCGGGGTGTGGAGGGCTCTGACTACATCAACGCCAG
CTTCATTGATGGCTACAG
gtaggtgccatgcctttcccacctcagggccccagaaggagcccatctctactctcaaga
ggcctccagtcttgtgggagacagagctggggagatactggtagccctgagctgtttaaa
tacacatctttagatgtatatttaactgatggctgctgtccgtgaatctttgggtgtgtg

Exon 31 +      76784      76910   2   Internal    127   100   Excellent
ccacatgcaaaatgggatcaccaggaggggaagtggtgcacccagcagccattcctggca
ggcagtggggtggtaggtgtagctgtcactggcttggtcctgaccctcccgggcagcatc
aggtgagtaccacgccgggtctccctgccggccctgggctcatacccccaacgcctgcag
GCAGCAGAAGGCCTACATCGCGACACAGGGGCCGCTGGCGGAGACCACGGAAGACTTCTG
GCGCATGCTGTGGGAGAACAATTCGACGATCGTGGTGATGCTGACCAAGCTGCGGGAGAT
GGGCCGG
gtgagctaggggccacagcagggaagggcgagggccagactgtggctcagacagcgctga
ccacggccgccatctcctccacaggagaagtgtcaccagtactggccggccgagcgctct
gcccgctaccagtactttgtggtagatccgatggcagaatacaacatgcctcagtatatc

Exon 32 +      76995      77120   0   Internal    126    76        Good
ccgctggcggagaccacggaagacttctggcgcatgctgtgggagaacaattcgacgatc
gtggtgatgctgaccaagctgcgggagatgggccgggtgagctaggggccacagcaggga
agggcgagggccagactgtggctcagacagcgctgaccacggccgccatctcctccacag
GAGAAGTGTCACCAGTACTGGCCGGCCGAGCGCTCTGCCCGCTACCAGTACTTTGTGGTA
GATCCGATGGCAGAATACAACATGCCTCAGTATATCCTGCGAGAGTTCAAGGTCACAGAT
GCCCGG
gtgagtgaagagacagactggcgggaggggctggagccttagtgatctggaaagggctgc
cctggttggtgatggatacaaaggccaagggttaggcataagcattgggaatcaggagaa
gtgtcagctgaccagttggccacttgcttctactgccacataggtggaagagagggtctt

Exon 33 +      78770      78831   0    Initial     62    61    Marginal
atgatggcaccattgggttgtagaagatgagtcatcattgatgagctatggacagtgatg
gagttgagttgtgctgtagggccccgaaatggcacagagtggaagatgacagaggatcat
ggtgaataggagctgggaagggcagagctggttgcactatgggatggcaaaggatggagg
ATGGAGGTGCTGGATGTCATACAGGAAATGTGGGGAGAGGAACAGCTGGGTGGCAAGAAG
TG
gtgaggatgaggttggagcatctcttatggaaagcagtaccattggattgtgaaggacgg
taagttgtcagggtaaatgaatggcagagagtgtacaaaatgggggtgagggccgggcct
ggtggctcatgcctgtaatcccagctaatcgggaggctgaggcaggagaattacttgaat

Exon 34 +      79198      79352   0   Internal    155   100   Excellent
aggtggaggttgcagtgagccgagatcacgccattgcactccaacctgggcgacaagagt
gaaactccatctcaaaaacaaacaaacaaacaaaaaatgggggtgaagatagggaggatg
gagaaaaacccccatggccgctgctgacctgataacaagattgggctctctgcactctag
GATGGCCAGTCCCGGACTGTCCGGCAGTTCCAGTTCACAGACTGGCCGGAACAGGGTGTG
CCAAAGTCGGGGGAGGGCTTCATCGACTTCATTGGCCAAGTGCATAAGACTAAGGAGCAG
TTTGGCCAGGACGGCCCCATCTCTGTCCACTGCAG
gtgagctccctcgagtgtcccagcttttggccctgctggggaaactgaggcctggtgggg
acagccccaagcttaggctgtcccatctgggctgttagagtcctcggggaatcgggtggt
cagatcagggctccccagcacctgcccctgaatggctgtgctcactttactgccaccagt

Exon 35 +      79532      79667   2   Internal    136    98   Excellent
ggtgagctccctcgagtgtcccagcttttggccctgctggggaaactgaggcctggtggg
gacagccccaagcttaggctgtcccatctgggctgttagagtcctcggggaatcgggtgg
tcagatcagggctccccagcacctgcccctgaatggctgtgctcactttactgccaccag
TGCCGGCGTGGGCAGGACGGGCGTCTTCATCACGCTTAGCATCGTGCTGGAGCGGATGCG
GTATGAAGGCGTGGTGGACATCTTTCAGACGGTGAAGATGCTACGAACCCAGCGGCCGGC
CATGGTGCAGACAGAG
gtaaagatgggacagggaggggaggcagcctggcctcacgccccgactgcccctaagctc
cagtttcctcctctgtgagatgggtacagccacctgggactctctgggtcactgtgggta
gacggtccacagacccctcccgcactggaaggggaccagtaacccttttaacacaacagt

--------------------------------------------------------------------------------