--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (137223 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (38 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1217       1233   0    Initial     17    51    Marginal
tcggggctccgcccttccccaggtaccgccccttcccgtcccgtggaatttggctctgga
ggaggtgggtcaaggactccatgccccgccccctgccccgcccttaccccgccccatgca
ttggcacccggaggggctcagctgacgccgcacttcacgtgacgccggtgccgggcgaac
ATGGCGGCGGCCACCGG
gtgagtgctgcgcctccctcgctctttcccgctggcgtggagaggggcatgggtgtcccg
gccggaccgcgggtgagagcgtcagccggggtcgctgaatgccgcgggtaggcgcctctt
cccgttggcccggagtcccagcgccggtcggcgagctgcacgctccgagtcagggtcagc

Exon  2 +       9863       9919   0    Initial     57    42    Marginal
aaggactgggtaagctcagctgagctgagggagggagccagttagggaagaggccccagg
gttgggccaagctggcctctagcagggaggttgagccgggagccaggggcctgcctggta
gggagcctggaccggctgctgttggagaaggtttccgcagagagagtggcccccagggtc
ATGGGCACCAAGTGGCCAGTGAGGACTGGGGACCTGCTGCAGATTCGGGAGCGTGGG
gtcactgtggcctgctgtgcagttggttggggggcagaggagcaggggggtggagtcagg
acagcatgggtggtggaggggagacaagcccctgtggtcctcagggggatcagtgagggg
ctgtttctgggtcataagtaggtggagcttgggcagcttgccccgtgctgatgggggtcc

Exon  3 +      10201      10384   2   Internal    184    99   Excellent
cagggggatcagtgaggggctgtttctgggtcataagtaggtggagcttgggcagcttgc
cccgtgctgatgggggtcccacggcaggctcgggcctccggtcaccccgacctcaggtgt
gggcatgcttggagatgctaacagaggcctgtgtggcggtgtgtgctcttgcctctgcag
ACCCTCGTTTTGGCTGGGGAATGAAACCCTGAAGGTGCCGCTGGCGCTCTTTGCCTTGAA
CCGGCAGCGCCTGTGTGAGCGGCTGCGGAAGAACCCTGCTGTGCAGGCCGGCTCCATCGT
GGTCCTGCAGGGCGGGGAGGAGACTCAGCGCTACTGCACCGACACCGGGGTCCTCTTCCG
CCAG
gtgagcctccccgcttggccacaagtgagcaggtgtgtgatggtgctgctgtcctgagca
ggagttggaggccccagcttggccagtgctgccccttgtggccctccctgagcctctgtt
tcctcgcctgggaagtggtccaggggctccttgaagatgtagaacttgaagatgtggggc

Exon  4 +      10528      10678   0   Internal    151    74        Good
gcgctactgcaccgacaccggggtcctcttccgccaggtgagcctccccgcttggccaca
agtgagcaggtgtgtgatggtgctgctgtcctgagcaggagttggaggccccagcttggc
cagtgctgccccttgtggccctccctgagcctctgtttcctcgcctgggaagtggtccag
GGGCTCCTTGAAGATGTAGAACTTGAAGATGTGGGGCAGCGGGTGGCCCAGCTGCAGGAA
ACCAGCCTGGCCATGGTGGCCATGGCTGAGAGTCACTGGCAGCACTCAGTCCCCAGGCAC
AGGAACATGAGGACACCCACCCAGGAAGACT
gtgaggctctgagctgggcccactttcacacatcttagcattatacccattttgcagatg
agaaaactgaggctcagaggggaaatgacttgccaagaggtggagctgggattagaactt
tgtcttccaactctaaatctagtgctgttttctccccgctgccatgcccagagctggagc

Exon  5 +      11822      11949   0   Internal    128    68    Marginal
caaactacgggaggatgagctggggagtcgagtgctgaggggaagggatgtctggggctg
gggtcagttacaggaggctgtcggtctgagctggctctctagggtgctgtgatgcagcca
ccggtccctccttgcacctcatgttccactggctaacaatagttcttgttcccgccacag
GAGTCCTTCTTTCACTGGGCGTTCGGTGTCACTGAGCCAGGCTGCTATGGTGTCATCGAT
GTTGACACTGGGAAGTCGACCCTGTTTGTGCCCAGGCTTCCTGCCAGCCATGCCACCTGG
ATGGGAAA
gtaaggagcagcctggccagggcaccatggctaccaaccatgggctgggggtgggtaggg
gaggtgggatgagagagctgggttgggcctggggacggggaggagggaagagctgcagga
ggaagggcatgcggtcagggctgtcacagcctgcctctcgccagagccctgcacccttgg

Exon  6 +      11976      11999   0    Initial     24    46    Marginal
aacaatagttcttgttcccgccacaggagtccttctttcactgggcgttcggtgtcactg
agccaggctgctatggtgtcatcgatgttgacactgggaagtcgaccctgtttgtgccca
ggcttcctgccagccatgccacctggatgggaaagtaaggagcagcctggccagggcacc
ATGGCTACCAACCATGGGCTGGGG
gtgggtaggggaggtgggatgagagagctgggttgggcctggggacggggaggagggaag
agctgcaggaggaagggcatgcggtcagggctgtcacagcctgcctctcgccagagccct
gcacccttggctgggaagggatgttagagctggagtatgactgtgtggtaggagttattg

Exon  7 +      17954      18087   0   Internal    134    62    Marginal
gccgcgggaaatggatggtgatggctgtaatttggccctgttacttattcattaatcgca
tgcaggtggtcagccagccagcaagacctgctttttgaaatttcattttctagagggctc
ctcgtgtctgcactgtgtggcattaatttaatgtctccttcccacccgtggcccccacag
TTGCTGGCAGTCACTGCAGAGTGTGCAGTCATGGGCTTTGACTCCGGGGACTGGGAAAGG
CCTCTCTCATCCATGCCAGGGCCCAACTGGGGTCCCTGGATGCTGACCCCTGTGGAGGAC
GAGAGCCCCTTTGG
gtaggaggacttctcctctctcctcccaaagctatccttggcatttgaggggagtgtgtg
tggggtgacagcagcttctctgctgacccatcctccccagtccagtaatttctttttctt
ttttttttttgagacagagttttgatctcatcacccaggctggagtacaatggcacgatc

Exon  8 +      28769      28975   0   Terminal    207    50    Marginal
acttatcaaaatgtctatgttaaatacaggcagcatagagtatgtcagtgatcactcaat
caagctgttaaaacaacaacaagttctcctcactctccccctgcgtttcgggtgtaaaga
gttaggataggggtgtggggagaggcgagggctgtggagatgagactgttctctgcccag
GGGGTGCTCAGAAACAAGAGGGTCTGCAGTAGCCAAGATGCAGGCCAGACTGAGGAGGAG
GGGCTGGCAGAGGAAGAAATTGCTCCCAGCAGGCTGGTTGGCACATGGCACTTTGCTGGG
GGAATGGTGACTGTCAGTGGGGCAGTAGAGGAGGGAGTGAACGAACCTGCCCAGGGGGCT
GGGGCTTTCATCCTGAGTGCACATTGA
tgaggcactaagatgggaagaaggcactcagggagagataagagctggagcagaggcgtg
gagagaggagctggcccggcatgcagatgcaagggcttgggccgggaagtaactggcttg
cagtggcaggaggtccaagtgggtcatggtggagggacagagagtgggctgtggggtggg

Exon  9 +      32920      32981   0   Internal     62   100   Excellent
aggtctgtccttgtgttggggccgggcctggagctacctggctgggtggctcatctgttg
ggggaaggcaggaggggatcctgttcttacctgtcctgagcctagctggaggcctcaggg
gtgcaggctgtgggggcgccatgcggccccgtgtgtcatgtctgtgttctctctccccag
CGTGGCGTCAACACGGACAGCGGCAGTGTCTGCAGGGAGGCCTCCTTTGACGGCATCAGC
AA
gtgagtcctgggcccccagggactctttccccaccatcccccactcccaccttcactagc
aggtctttcccggtctacaaataagacatgaactatgcaaacttctttttaaggagtttg
ggcattttgaggaaatgtttagaagcataatttgccaaaaatcaccttgatttttcttga

Exon 10 +      34434      34832   2   Internal    399    53    Marginal
cctccccctatgctaagagcagtggggcgggtggaggggcgggtagtaggtttgcttttt
cactgcacagatcttcgtgtcctcctgggagtttccccaaagcggccccgcctcccacgc
ctggcagcaattagcccagcttgttgaaatgctggccatggagctgctctctctccccag
GCCCCCAGGCCCTCAGAGGGGCTACGGGCACAGCCAGCTGCTGCCTGTCCCAGTCCCGGG
ACTCCCTGAATCCCCCCAGCACTACCTGGTGCTGGGTCTCCAGTGTCCTGCACACCTTTC
CTCGACCATGCCATGGAACCTCTCTATGGCCTCTGTTTGGGTCTCTGCAGCAGGGGGACC
CTCAGCTCCTCCACGTGTAACCTGGTGCTGCCTGGGCTTGTGGTGGGCACTGGAGGAGAT
CATGCTCACCTGGAGCCTGGCACAGAGCTGGTGCTCAGTGACAGTTGCCCGCATGCAAAC
CCCAGCAAATCCCATTGCTCCTCTGTGCCTCAGTCTCCCCATCTGCGTGGTGGGCCAGGT
GGGCTCCAGGATCACCAATTCCCAGTTTCCCAGATGTCA
gtgagtcgagggccttctcagcggtgagagctttgcttgctcctcctctagagagaatgc
tgagcccccctggaccacgtctggcagctgtgtggtgggtgtggttcccagccaggagct
caagatgtggcctctgaagcagagctctgccagctgctccttgaggttccccgaggaagg

Exon 11 +      34884      35015   2   Internal    132    89        Good
gtgctcagtgacagttgcccgcatgcaaaccccagcaaatcccattgctcctctgtgcct
cagtctccccatctgcgtggtgggccaggtgggctccaggatcaccaattcccagtttcc
cagatgtcagtgagtcgagggccttctcagcggtgagagctttgcttgctcctcctctag
AGAGAATGCTGAGCCCCCCTGGACCACGTCTGGCAGCTGTGTGGTGGGTGTGGTTCCCAG
CCAGGAGCTCAAGATGTGGCCTCTGAAGCAGAGCTCTGCCAGCTGCTCCTTGAGGTTCCC
CGAGGAAGGCAG
gtggggccctgggcttccccagggccctcatcactgtcagtgagtgtcaggaagcaaagg
tctcgttctaccccccaggaggattcctaggtgtgacctctcatcccagtctctgtcacc
tgttgccccccagtccctgtggcctctgccaagagcccagaggagcctgtgctctgcaaa

Exon 12 +      38873      39114   1   Terminal    242    62    Marginal
gtggcatttggtgcagtgggagccagagtctattttgtagttttgatttatgtcacctgc
tgccctgttcttcactttgaaccacactggctgcccgtagtctctttgatatttcataag
taaggctttgattccacaacatttaggttgactttgaatcatatagttctgtttgtatag
TTAAGGATCCTGAAAGCTTCAGACATCTGGAATCCTCTCAGTCTGCTGTTACCCCCTTCT
CTCTTCTCTCCCCTGTCCCTGCCCCTGTTCAGTTGGCTCAGCTAGAAGGGCTGCTGGCCT
CACAACCATGGCATTACATAGGTGTTTTCAACACCATTAACGAAGCCATGGAGGGTCCCT
GGCTGGCAGGAGGACAGGAGGTCACGACCCTGCGTGTGCTTGTGTGTGCTATCCTTCCCT
AA
gatggggcaggtctttttttcttttttaaagagacaggcttttttaaagagactgggcaa
gagtcactcttgcccaggctgctggagtacagtggtgcaatcatgaatcactatagcctc
aacctcctgggctcaagcgatcttcccaccttagccttctgaatagttgggactataggt

Exon 13 +      43248      43403   0    Initial    156    76        Good
aattgttctaacaacacatgcatgtgtatgttcgctgcagcactattcacaatagcaaac
acatggaatcaacctaaatgcccatcagtggtagactggataaagaaaatgtggtatggt
atgcaccatggaatactatgcaaccataaaaaagaatgagatcatgtcctttgcaagaac
ATGGATGGAGCTGGAGGCTGTTATCCTCAGCAAACTAATGCAGGAACAGAAAACCAAATG
CCACATGTTCTCACTTACAAGTGGGAGCTAAATGATGAGAACACATGGACACATAGAGGG
CGACAACACACACTGGGGCCTATTGGAAGGTGGAGG
gtgggaggaggaagaggatcaggaaaaatagcaaaataactaatgggcactagacttaat
acctaggtggcagaataatctgtacaacaaagccccattacacaagtttacctatgtaag
aaacctgcacatgtacccctgaacttaaaattaaaaaaaaaaaaagaattcattcgccaa

Exon 14 +      44341      44383   1   Internal     43   100   Excellent
gtttttctttcagggtaggtctgctagtaataaattctcttgggttttgcttatctggga
tgttgtagttctccctcatttattaataatggctttgctggatatggaattcttggtgga
cttttttttttaatctttcagcactttaaatgtcatcccactgccttctctccaccatag
GTTTTGATGAGAAATCAGCTAATAATCTAATTGAGGATCCCTT
gtaagtgatgaattattaatacttttctcttgctgctttcaagatacttttttgacagtt
tgattatcatgtgtctaggtgtggatatctttgaatttatcctacttggagttcatggag
ctttatggatatgtagattaatgtttttcatcaaattggtgaggtttttgctttctctgc

Exon 15 +      44887      44935   2   Terminal     49    87        Good
ccaggctgccaggtctgctgaaggaagggatcaacaggccttttgtgggtcaggaagtca
tgaaattaaagtgtgggaccctctttaatgcatcacgtgtgcatgtcttgaatgaggtag
ttcttgctgggacatgacagaccgttggattaatgggcttgatttcttttcgccctacag
GTTCGAAGTCAACAATACCATTCTTCACCCAGAGATCGTTGAGTGGTGA
gtacggcctgtggtcaccttgcctgtttgttgtgctcggctcatggggatggaatgccct
gttgttcctgcccacaccgtctcagagagcccctcagaaagcagattcccagaaccttct
cccatagccttttctgttttgcttgttctttgttgttggttgactggccgtacttttttt

Exon 16 +      45545      45655   0     Single    111    42    Marginal
gttagcccttacctgctgcacaactggcttctactagctgcctacaaagtgagctgtctt
atgctgggcgccacctctgtgggccctggaggtggccctcgcatcccagtgtgccaccag
ttttcttcctaagccatcgcattgctctttgacagcagcaaggcattttttctttgatgg
ATGGCTGCACGTACTGAGAATGTAGAAGAGAGGCAAGGCCAGGCCTTTGCCACATCATCA
CTTGCCAAGGAGATGTGTAGCCTTCTCACATATGACCCTAAGTCTGTATGA
tcacattttctttcctgtctagctgggagctctgactcgcctcgtcttagagcttgggac
caaggaggtatcctgaaagatgaatgggcatcggctgtggaaaaagaaggagtaggagag
agtgaccctggcaaaaggaccactcgttcacagaaacaagagaaagggtggtggctctgt

Exon 17 +      54527      54628   0   Internal    102    60    Marginal
gaccgtgtgagtcagcggctggctggcatgggctgctcccttgaagttcccaagggcttg
ctgcctctgatgggagtgggggagccaccaggcccctcgcattcccgccatcctcgcctg
cctcggggcctctgtctgggctgcctcgatggaggccagctcaggtgggctcttggccag
GCCGAGGAGGAGGAAGAGGAGATGCAGGAGAGGTGCCCTTTGACAGAGGAGCGAGTGCTG
GTCTGCGTCCTCAGACACCCCAGCTTTGCTCCCAACAGAGGG
gtgggtgctggtctgcatcctcagacactccagctttgctgatcttgagagtgtttgcat
tgatacctttgtgagagtcacgggtgggcctttgggagctttggtgcaggtaagtcatct
ttagtaaaggaaaaggagctggccagggggtgcaccgggaactctctgccttgtgcagag

Exon 18 +      58576      58702   0    Initial    127    50    Marginal
acacgaaactggaatggcttctgtcccttcacctgaccctgtcacccacccgtgggcagg
tgggtgggggtggggaggaaacgaggcctcttcagccaacaggacagagccctgggaggc
agcaggcttaggattatggcccagtagccatgccatgtagatttcatcccccttccatgc
ATGGGGAAACTGAGGTTGAGGGAGGCAGCCTGTGACAAGCTGCAGCAACCAGGCTTCTTC
TCCCACCGCAGCGGCTTCCAGATCTTATCCCTGGAAACAGTCTGCCCGCTGGCTGGTGTT
AGGGAAG
gtgggcagcagctctgctccctgctagaggttttcttctagactgttccatggagcttgt
cactcctgggccttggtggccccactctggccttgcacaacacgccttctgggctgtgca
gggtgtggtaggccctgagctctccctggaggggtccagccagtgcctcctgaaagtcac

Exon 19 +      58934      58990   0    Initial     57    63    Marginal
ggagcttgtcactcctgggccttggtggccccactctggccttgcacaacacgccttctg
ggctgtgcagggtgtggtaggccctgagctctccctggaggggtccagccagtgcctcct
gaaagtcactgatttgctgctttgttcttctgtctctgaagccgagtgtttaagacggat
ATGGAGCTGGAGGTTCTGCGCTATACCAATAAAATCTCCAGCGAGGCCCACCGTGAG
gtaagtcaggcaccggctctggttgagtggggaaagcagtgttgctgtgtggcgagagaa
ctgcgtgaggatgaagggtttccaggtgggctctaatccctgagggccaagtgagaggta
ggaagttttacacagtgattgttctcttttctgttccctggtgggcacagggcagggaca

Exon 20 +      59936      59982   0   Internal     47    94   Excellent
ggattttggagcttttaaaaagttctaatttgtcacatgtctgtaccactgcatgcacat
atcattctttttttcctttttaaagaagaggtgcttttgaagaagtgctgtatgttattt
atcacgctgtgttactgatctgcttaatacaaatgtctttgcttaatatccgtcctccag
GTAATGAAGGCTGTAAAAGTGGGAATGAAAGAATATGAGTTGGAAAG
gtaagccaccatgtttctccgggtaaaattaaaaggtaaaaaacagtaatttatgttccc
tgagtgagtaacagatgagacgccgcagtggcacacacaccgtgagcggagattatgaac
agggcttcaggatcacaagcaaagattatttttcttctgactgcgcccgcctccctggct

Exon 21 +      70753      70834   1   Internal     82    62    Marginal
catctgtcttttaacttgtttagttgaatcttagtttattttttattttttcctctttag
taataaatagattttggctagtttatttttgaatactgccttagctatatcctggtatgt
ctagagtgatttgtttttgaacctaagaactaacctagtgtatttcttttcatttcccag
TAGATGTGGTTGAATTTTTCTTGGTGACCTTTTGGTTTTTAGCTGCTAGTTCTGTCACCA
TTGGAGCTAGAGAATGCAGCTG
gtgtgaatctttttggtttttaattttgaagtttttcttcgtggcttatttaaaaatatt
ttggtcagtattttatggaatactggaaagtgtttagtttttatctttagaatatatact
ttggtgtacatgaatcaggtttattatctaattccagtcctctgccccctcccctatttt

Exon 22 +      73592      73705   0   Terminal    114    76        Good
ctgtctcccattctcctgctgtgaccctgcacactcgttctgctgctgttttcttgtgtg
cattttgtggcttggtcccttcctgttttggcgcaggcttctccggtgagctctcctcat
ggatcctgagaaaacatgggctggtggatctttttaggtttcctctcatttttcacccag
GAGACCTCTCTGGCTCTTTCTGCACAGCTGGCCAAGAGCTGTCTGATTGACCCCACCATG
CGGGGCTCTGCTGAAATTGCTCAGGCCCAGAAGAAAGGGGGAGGAACGGTTTAG
gttgcttgtaggttcactgtgcaagatgggcgaccccagaggagctgaggagggggctat
gagttgcaccaggtggtccagacagtaccgagtcacctcggtggacatggaagatgtctt
ctctacagtgggccagctacctggagttggctttggccacacccccatttgctgcctgcc

Exon 23 +      73731      73901   0    Initial    171    59    Marginal
gctggtggatctttttaggtttcctctcatttttcacccaggagacctctctggctcttt
ctgcacagctggccaagagctgtctgattgaccccaccatgcggggctctgctgaaattg
ctcaggcccagaagaaagggggaggaacggtttaggttgcttgtaggttcactgtgcaag
ATGGGCGACCCCAGAGGAGCTGAGGAGGGGGCTATGAGTTGCACCAGGTGGTCCAGACAG
TACCGAGTCACCTCGGTGGACATGGAAGATGTCTTCTCTACAGTGGGCCAGCTACCTGGA
GTTGGCTTTGGCCACACCCCCATTTGCTGCCTGCCTTCCCCCGAGGCCCCT
gtgagagtggactgcagcctctgggggcctctgtcccgtcagggtcttggttggggagtg
tggggaaaccctgggtccccacctctcattctccaggaagaattttctagcaagagaaag
gccagagtttatatactggtggcctctgggccacatccagtacacacgcagtttccgttt

Exon 24 +      79741      79898   0    Initial    158    57    Marginal
tttttattaacttgttcagtcatgtatcaagagtggcaaattacaatctcacattctccc
caaagtggaaaagaatccaaatgtccaccaactcctacacggataaataaagtgtggtgt
gcagtctagccatacgagggaatagtattcagtaatttttaaaatgaagcacagggacat
ATGACAGAATCGATAGATCTTGAAAACATGGTGTTCAGTGACAGAAGTCAGAGAGCCACA
CGCTGTGTGATTCCATTTGTGCAAAATGTCAAGAACAGGCAAGTCCACAGAGATGGGGCA
ATGAGCTTCCAGGACCGTGGGGGAGAAAGCAGGGAGGA
gtgactgcagatgggtaccgagtttctttggtgggtaataaaaatgttaggaaattggtt
ttgtcagcaaacatttatgatgcacctactgtgtgccagatgctgttctgggccctgggg
aggcagcggtggaggaaaggcccagcccccgtggagcacagttctgtggggagagccagt

Exon 25 +      86555      86655   0    Initial    101    45    Marginal
tgagaggaccttcctggcaggacctaaacatcttcttctcccagcccctctgcccctgca
ggggagtggggtgggtctctcgagtgcggcctgccaggcaggaacttggctcatagccca
tgcagccatgcagccttgcagcccaggcaggactggagccctcagaccaggcccatcatg
ATGAGGCAGAAGCACCCCTGTACTCGGCCATTGGGAGATGCTGAGGACGGCTCCCGCCTG
CCTCTTAGGCAGGGCATGGGGCCTGCTGGGAAGGCTGCCTG
gtgagtaccctcattccttctcttcctcccatgcttctttctcttctcactcctcctctt
cttcctgctcgcctctccttctctccctcctctccctctccctctccctcttctctttcc
tcttccttctcctcttcctcctctttctccctctccttcctcttcctccatcttccttct

Exon 26 +      99912      99976   0    Initial     65    54    Marginal
aacagaggtataccaaagacttctgatgtgccaagcactgttctggtctcttgagggata
ctacagtgaacaaaaagataaagctcaagcctaatgggaggctagagatggttggataga
tggatggatggatggatggatggatggatgataagtaggtaagtatgtaggctgatatag
ATGATCATCACCTTGATAGATGATGGATGGATAGATAGGATGATGGCTGGATGGATAGAC
GATAG
gtaggtaggtagacatagaaacagataattgacagagtattggatgagtagatagagtga
taaatggatagatgatacgtaggtagatacagaaatagatgattgatagaggaatagatg
gatgggtggatagatatagagagatggatggatggatagatggatagatagatagataga

Exon 27 +     107128     107246   0   Internal    119    93   Excellent
aacttgggtgcccttgtgcgtccacaccccaagcctaaagtctgcagaaaacgtgggctc
gttttgcccacctgttattgccaccaaagcaccagtgtgtcctcaagttgcgtcagaaaa
ggtcatttaaaacaaaattcaggactgaagtccactgtgaagcatttcagctttttttag
GCGGGCGTGAATATCCAGCACGTGGTGCTCCTCCTCTTTTCAACTCCTTCCTATGGAACA
GTGTGTGGAGTTGTCAACGTGGCCGGCAAAGGTGACCAGTGTCGGGCTGCACTTTGCAG
gtgaaaactgggtcagcctttctttagtttgatgcttctgtgagctgtgccttcttgaag
gcactatttttttcttaaaaagcagcaaaggcattcaaagacagttgtctccactgagtg
ggttatgcagggggaagcttgctgcaggcgagagagccaagtttcctcactgcctcccct

Exon 28 +     109334     109402   2   Internal     69   100   Excellent
cagcctatgactgacccccaggctgtaagcctcacagactcacactgagagtttggacca
ttgtggggccacggcaggggagaccatgggccgagggccttcccttggggttcatggggc
tcgtggagtggggtgtgcctgctctagtgccccaaccctgacgcgtctctccccctgcag
CCTCTTCGAGCACTACTGCTACTCCCGGGGCGGCATGCGCCACAGCTCCTACACCTGCAT
CTGCGGCAG
gtaagcggggcaccctggctcccctgggggtgaccagtgggaggaggtagggcagttagt
gagtggggggctccaccatcccccagctcagccacacttgctcactcacacgcccacacc
agcgcccggcccaagcttggaagtcgctcctccctcccaagactcccggagctgaggtgg

Exon 29 +     111228     111305   2   Internal     78    89        Good
gacagggccaccatgtcccccggccttacctctggctgtggacctggtccagccacgcct
gggcctgtgctggaggtggggacagtgctgctcatgggcaggggatcgagcatccacccc
ctccttcagagcctgctgcagaagaatgggctttgatcaccctcccccggctctttgcag
TGGTGAGAACTCAGCCGTGCTACACTACGGACACGCCGGAGCTCCCAACGACCGAACGAT
CCAGAATGGGGATATGTG
gtaagtagggccagcggccctggctctgtgtgtgaacagccaggccaaggttggactcaa
cttcaagatggcccagaagcctctgggtccctgtcctgagagggctgaccacagcaagtc
cctgggcttcttggcccagacttctctgccaaggctatcggcctgcgtggtgccttctcc

Exon 30 +     111755     111880   1   Internal    126    80        Good
tgggctctctgagggggcctgaaccatccccagcctctgtccaggctgtcctctccgttc
agggggcaccacgctcgcatctttctgtcttggtgccaggagggcaggcctcttggtctg
gagctgggaagaccgcagggagcctcccacgctctgaaacctgccatcctcctgctgcag
GAGCCCGTGGCCTCTGCGGCCCTGCGTTCAGCAAGTCAGCAGTGCTGACCCGTGGCTGCG
TGCAGGGCTTTCCTGAGCACGATGTGCCGTGCTCACAGTTCTTCATAGAAGCCACGACAA
GGAGAT
gtgggcaggccctgcggcctccgcccctcgggtagtcttttctctcattggaggacttgc
agtcctacccacagcccctcggtgtgcagggcagagcagctgggccgctgccccggggca
gggaggaggtgtgtgagtacttgcagcctggcctctgctcagtccctccgcgttctttgc

Exon 31 +     114586     114709   2   Internal    124    90   Excellent
gtactgcagaagggtggggggtactaagaggaggccagccttttccatccctctctccac
agtcccagatatgagcactcccccaacacgcacacacatggatacacacacagggaactg
accgaggctgtgctgcgttgcaatgatcacagtgtaagcccctgcctccctctctcgcag
TGGCCACCTGGCACAGCGTGGGCCCTCTTCGGGCAAGAGCAGCAGGCCCGGTGTCCTCAC
CGAGCTGGGCAGGCCAGGCCCTGATGCCCACTTCCAGCAGCTGGTTCTGCAGCACAGGCT
GGAG
gtgggagccacaggcagagctcaggccaggcctggtttattctcagacagctcccgtccc
ctggttgtcctgttccgtgtcttcgacccaaaagtgtcctccatgatgcgtacatcaagc
ggggtttggggctggctaggcccccctcctactgctccgtccttacccttccagcagctt

Exon 32 +     116134     116300   1   Internal    167    70        Good
gccagaagagggcagtgttgtctcaggacgatgggccaggcctcacccctgctgggcctg
gtcttttgtgttgctcctgggcatggggggtgggtggccagcctggctaggaggagagac
ctgtcccagccctcacactcagcagccaccagtgccctcttcccctccttccctggctag
ATAATGGCGAGACCTCGACCCTGCAGGCCATGGGGTGCCCGCTCACCCAGGACCTCAGCA
GCCACCTTGGCCTCACATGGGCCCTGCAGCCTGGGATGCGGCCAGCCTACTCCTGCTGTC
TACTCAGCCTGAGTCTGTCTGCCACCATCGCGCTGCGGACCCCATGG
gtgacaagctcctggggacccccttgccccactccacctggggcccaatgctttggtgag
ctccagggtagagcgttgcccccaggcctgctctctgctgcctgtcccagcccagctctc
ccccaccaccttgctgtttcctccgagggagacttgttgtcaccagccagccctgccctg

Exon 33 +     121004     121267   0   Internal    264   100   Excellent
ataggacagccccactcccctcagccttccctgcctgggctgagccctgagtcccttttt
ccctggaagacacaggtcttccaggatggcttcgggtttccttgctgcccacgcacccgt
gggagacaccaggtggcagttccccacaccggtctcattgtgagggggagttgcatccag
GACCCGGGCCAGCTGCCCTCGAGTCCAGGGCAGGTGGGGAGCGGTAAGGGTAAGGGGGCG
GTGGCACCCCAGTACCCACTTGCCCTGCCTTCCTCTCTCCGCAGCCTGTTCGACATGGGC
GGTGAGTATTACTGCTTCGCTTCCGACATCACCTGCTCCTTTCCCGCCAACGGCAAGTTC
ACTGCAGACCAGAAGGCCGTCTATGAGGCAGTGCTGCGGAGCTCCCGTGCCGTCATGGGT
GCCATGAAGCCAGGTGAGCAGCGG
gtcggtggggggaggcgcatctgacgtggcgttgggggcgctgctatgtggcaggtgcct
gcagggaacgggtctgcattgtgtgacttgaatctgccacactccagatgcttagtccct
gagattccagtggcgtcaggtctccagggtcactcctaggaaacaaggctgaccaccagg

Exon 34 +     124965     125066   0   Internal    102    77        Good
gcagtgccgggcccatcagggtgccagaggtagcaccaggccacggggagcagggcggcg
gattgacgcagcataggggccaaggcctggggggtgttcggtgggaaagccattgtctta
cccctcagtctcctgtgctgaaaccagggatggcccagccctggctggcctcacctgcag
GAAAGCCTGCTGCGGCCTGGGCAGGACCTGGGTGGCATCTCCACAGCTGGCATCCTGGCC
AGCTCCCTGGCCCAACTCAGCAGCCCCAATTCTGTCCAGAAA
gtggccagacctcggggcaagtccccaggccccatgtggcactgagaaaggcctgagctg
ggtctcccatcccgtggtgctgcctggttcatgctgactcttggggcaggcacaggcctc
aggcctggcaggggtgtctggggccacaaggccaaatccagctaggctcatctcagacca

Exon 35 +     126443     126579   1   Internal    137    63    Marginal
cccccaccctccctggcctccccgcctttctctactctttcctgtgctcacccaggagcc
tcctgtgcccctgtcactgggggcccagctcctatcaacctggaacagcaatggtggccc
acgattcatgagctcttttgtgtttcgttcccccgctcctggctctgtccctgccctcag
GGTCCTGGCCACTTGTGAGTGACGGGGGTGCTGCCAATGTGAGGTCAGAGGAGGGGAAAG
AAGTGGCAGGAAGTGTCCCCACCTCCAAAACAGTCCTGACGGGGCGAGAGAGGGGCACTG
AGGCGCGGGATGACCAG
gtggctgggagaggggcccagcagcacctgccccggcccacctggcatgtgtctcctgtg
gccccgtggtcagggggcacctctgccagctttgctcccctcccagccagcgccaggggc
aggggcccagcagctagacttcctgtcagtcctcatcctccgagacggcgtggagtgcag

Exon 36 +     131434     131682   0   Internal    249    83        Good
tagaggcagaatggagggacaagaagggtcccgagggccagagcttttgctgggaaagcc
cagcacggggggccaccctagtccttgtccccctgggcccccgatgtagtacccttgccc
cctcaccccccacctcaggccctcccaccacagccagtgtgagggcttcacatctcccag
CCCCTGGCCCTGCGGTGTTGGCTGCTGGGCTCTGTGGCTCACGGCAGCTCCCTCTGGCCC
ACAGGTGTCTGGTGGCCTGACATGCACCGCCTGGCTGACCGCATCCACCTGGAGGAGCTG
GCCCACATGGGCATCCTGAGCGGCAGCGTGGACGCCATGGTCCAGGCTCACCTGGGGGCC
GTGTTTATGCCTCACGGGCTTGGCCACTTCCTGGGCATTGACGTGCACGACGTGGGAGGC
TACCCAGAG
gtcagtgtggacatggcaggcggagtggcctgcccatcagctgccgctgagcctgacccc
cagggcagggtgggactctaggaggcagcaggcgtgtattgggatggcagggatgggccc
catggctccctgtggtatacggaggccatgaggaggggggaatcgggaccctggccaaga

Exon 37 +     134896     135087   0   Internal    192   100   Excellent
gtggaaggtcttatcagggtgcccatggcccagcacagcaggggcgagtctaggctgagg
accccaatggtcaagagagcccacgagactggcaccggccctcacatgcccatctctcct
gatgaggccacggtgagccctggagctgctcatcaggcccctcacctctgttccccacag
GGCGTGGAGCGCATCGACGAGCCCGGCCTGCGGAGCCTGCGCACTGCACGGCACCTGCAG
CCAGGCATGGTGCTCACCGTGGAGCCGGGCATCTACTTCATCGACCACCTCCTGGATGAG
GCCCTGGCGGACCCGGCCCGCGCCTCCTTCCTTAACCGCGAGGTCCTGCAGCGCTTTCGC
GGTTTTGGCGGG
gtgagtgcccacgggccccattcttgctcccagaacatctgccacctccactgcagctgc
agactccttagtcccaagacaggggccctagtgacatcttcccttgaggtgggcttagcc
tgccccttcgtgtggtctgtcacaggatggagcctcacccctcagtaggaacagacagag

Exon 38 +     135496     135633   0   Terminal    138   100   Excellent
agacagggtgagcaggtgacatgggcagatggctccatgaaggagcccggaggccacccg
tctcccagggagtgtcagctgctcccatcccatggtggggtgggcctggaatgggcccgg
ccctctagcctggcacatgaggctgctctatgataatgtgtgtctgtcggcttgacccag
GTCCGCATCGAGGAGGACGTCGTGGTGACTGACAGCGGCATAGAGCTGCTGACCTGCGTG
CCCCGCACTGTGGAAGAGATTGAAGCATGCATGGCAGGCTGTGACAAGGCCTTTACCCCC
TTCTCTGGCCCCAAGTAG
agccagccagaaatcccagcgcacctgggggcctggccttgcaacctcttttcgtgatgg
gcagcctgctggtcagcactccagtagcgagagacggcacccagaatcagatcccagctt
cggcatttgatcagaccaaacagtgctgtttcccggggaggaaacacttttttaattacc

--------------------------------------------------------------------------------