--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (7938 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1463       1540   0    Initial     78    96   Excellent
cttccgtccctggagaggaggcggcgccctgtatcggccttcgtcctccgcgggtgtgct
agcgttgggacggtcctttgttgccgcgaggggtaggagtgggcgtggcggagccagctc
cgttcggaacactcccgggccgacccgactcgctcatcctgcaggagctgcggcgccaag
ATGAGTGGAGAGGAGAACCCAGCCAGCAAGCCCACGCCGGTGCAGGACGTACAGGGCGAC
GGGCGCTGGATGTCCCTG
gtgagcgttcccacctgggatattgaggagtccgggggcgcggggggtggctcaggagaa
cggctggttcgtgccactctcactacctgattgggaaactgagggcagttgaggaggcgc
tgcctaagggagcagggcggggcgggccctggagcgtgcatgccattgactccctctcgc

Exon  2 +       1733       1815   0   Internal     83   100   Excellent
acctgggatattgaggagtccgggggcgcggggggtggctcaggagaacggctggttcgt
gccactctcactacctgattgggaaactgagggcagttgaggaggcgctgcctaagggag
cagggcggggcgggccctggagcgtgcatgccattgactccctctcgcgcgctcccgcag
CACCATCGGTTCGTGGCTGACAGCAAAGATAAGGAACCCGAAGTCGTCTTCATCGGGGAC
TCCTTGGTCCAGCTCATGCACCA
gtgcgaggtgagggcagtccctctccccctgccccatccagccctgtgtccatgctgaca
catctggaccagaacccaggccaggtgaggtattatgagagtacccagattggcctcagg
cagcccgaggctctgagaatcttggtgtaaggtgcaacattctattgagaaagaaatgta

Exon  3 +       1857       1959   2   Internal    103    68    Marginal
gcggggcgggccctggagcgtgcatgccattgactccctctcgcgcgctcccgcagcacc
atcggttcgtggctgacagcaaagataaggaacccgaagtcgtcttcatcggggactcct
tggtccagctcatgcaccagtgcgaggtgagggcagtccctctccccctgccccatccag
CCCTGTGTCCATGCTGACACATCTGGACCAGAACCCAGGCCAGGTGAGGTATTATGAGAG
TACCCAGATTGGCCTCAGGCAGCCCGAGGCTCTGAGAATCTTG
gtgtaaggtgcaacattctattgagaaagaaatgtatgccttggttttatcagattggat
ttgtgtataatgtactaagacctaaaatgaggctttcctgccataggcttgcctaaagtg
aggctctttcttgtttgctttaagtagtgcgcagccctgttgggtttacacaaagctata

Exon  4 +       3485       3601   0   Internal    117    98   Excellent
ctataaagtgaggttcagccatgctggagtttgctccaggtaaaattttaagactgcttc
catgaagtaaggttcttccataatggcatttggttaacacctggacagagggggatggtc
catgcggacagtgcccttgtgcccctaccacttcttgcccacaccacttcttgcccacag
ATCTGGCGCGAGCTCTTCTCTCCTCTGCATGCACTTAACTTTGGCATTGGTGGTGACGGC
ACACAGCATGTACTGTGGCGGCTGGAGAATGGGGAGCTGGAACACATCCGGCCCAAG
gtgagcggggcttgggtggggctctaaaacatcttttggctgccccctcaccgctgcttc
atgtctctttttccacagattgtggtggtctgggtgggcaccaacaaccacggacacaca
gcagagcaggtgactggtggcatcaaggccattgtgcaactggtgaatgagcgacagccc

Exon  5 +       3680       3802   0   Internal    123   100   Excellent
ttctctcctctgcatgcacttaactttggcattggtggtgacggcacacagcatgtactg
tggcggctggagaatggggagctggaacacatccggcccaaggtgagcggggcttgggtg
gggctctaaaacatcttttggctgccccctcaccgctgcttcatgtctctttttccacag
ATTGTGGTGGTCTGGGTGGGCACCAACAACCACGGACACACAGCAGAGCAGGTGACTGGT
GGCATCAAGGCCATTGTGCAACTGGTGAATGAGCGACAGCCCCAGGCCCGGGTTGTGGTG
CTG
gtgagaggctgggagagtgggaaaggaagaatggcagtggtctgggaccccctcagatat
agccacagttggcacagttctaggcagcttgacatagagcagtggcttttaggcagaatc
tcacgttggagcttgctatacccttcagagtggctgtggttgagaatatgctccgagacc

Exon  6 +       6407       6694   0   Terminal    288    81        Good
tcttgctaaatgagggctaggatgtgatatttaggaactaccctcccaccctccccactt
gcccatccctagtgttttctgcagctggaaacttcatggtggtgggtggaggacaggttg
gcacagagaacaagatactcaaatgcttgtttccttactacgcctcgtgttcctgctcag
GGCCTGCTTCCGCGAGGCCAACATCCCAACCCACTTCGGGAGAAGAACCGACAGGTGAAC
GAGCTGGTACGGGCGGCACTGGCTGGCCACCCTCGGGCCCACTTCCTAGATGCCGACCCT
GGCTTTGTGCACTCAGATGGCACCATCAGCCATCATGACATGTATGATTACCTGCATCTG
AGCCGCCTGGGCTACACACCTGTTTGCCGGGCTCTGCACTCCCTGCTTCTGCGTCTGCTG
GCCCAAGACCAGGGCCAAGGTGCTCCCCTGCTGGAGCCCGCACCCTAA
gcatcctgctgccttcccacaacattaaactctccttcctcagtgtgctgtttcctgctt
tatggtcgaacctgtctgggtatctgggtaccaccattagtccttatcctgatctgtgac
cctgcagttctgcaaggtgttttttgtgtgagacagggtctctctccgtcacccaggcta

--------------------------------------------------------------------------------