--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (98746 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (11 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +      16297      16922   0   Internal    626    91   Excellent
ccttttgcgtgcctccggcggcgtgcacgggtccgcagcgaccccctgcccacctctgcc
cagcccctcccactctgcgggtctgttcagggcccctccgacctcagccttcggggccgg
gcagtgggtccgccctctgcgtccctggcgctcctgacctctcgcctctccggcctgcag
GATGAGTTCCACCCGTTCATCGAGGCCCTGCTGCCTCACGTCCGCGCCTTCGCCTACACC
TGGTTCAACCTGCAGGCGCGGAAGCGCAAGTACTTCAAGAAGCACGAGAAGCGGATGTCG
AAGGACGAGGAGCGTGCGGTCAAGGACGAGCTGCTGGGCGAGAAGCCCGAGGTCAAGCAG
AAGTGGGCGTCGCGGCTGCTGGCCAAGCTGCGCAAGGACATCCGGCCCGAGTGCCGCGAG
GACTTCGTGCTGAGCATCACCGGCAAGAAGGCGCCGGGCTGCGTGCTCTCCAACCCCGAC
CAGAAGGGCAAGATGCGGCGCATCGACTGTCTCCGGCAGGCGGACAAGGTGTGGCGGCTG
GACCTGGTCATGGTCATCCTGTTCAAGGGCATCCCGCTGGAGAGCACCGACGGCGAGCGC
CTGGTCAAGGCTGCGCAGTGCGGTCACCCGGTCCTGTGCGTGCAGCCGCACCACATTGGC
GTGGCCGTCAAGGAGCTGGACCTCTACCTGGCCTACTTCGTGCGTGAGCGAGGTGAGGTG
TGGTGGCCTGAGCGGAGCGGCCAGCGGGGAGGGTGTCTGATGGTGGTGACACGGGGCCAG
GAGGGCCTGAGGGAGGAGGCCAGTGC
gtgtgggtatgatgtggtggtctgagaggggaagtgggccttggagagtgcccaatgggg
gcgacacggggcacggagcatctgagggaggaggctggtgggtatagatgtgatgtggtg
gtctgagaggggaggcgagtctaggagaatatgtaaagtaggtgatatggcacaaggaga

Exon  2 +      22670      22738   0    Initial     69    43    Marginal
gcccagggcctaaacccagccaggcctccccgccccctctggcagcccaagaaatctgag
gcgcgggcgggcaccgtgccagggctgggcgggggaggggctgccaggcccgcccgtccc
agcagctgccagcccgccccgagccgccagcccagatggtgcccatctgctgacgccgcc
ATGGGCCAGCCTCCTGTTCCCGCCTTGCGTCGTGCCAAGCTCCTGCAGTCCAGCGCCGGG
AATGGCGCG
gtgggcagagcccggcccgggaagctcatagcacgccagagaggctgccccgggtgccct
ggagagggtggcaggagaaacatgggagggggagttccccagcgcttcctggatggaatt
ggggagcaaggaccccaacagcgataatgatggcggcaaacacacatggcgtgccctctg

Exon  3 +      26464      26564   2   Internal    101    77        Good
aggcaggagaatcacttgaacccgggaggcggaggttgcggtgagctgagattgcaccac
tgccctccagcctgggcaacagagtgagactccgtttcaaaaaaaaatgttatatatgta
acaatgtaataattagtaatatgtcatatataatcatggaacaataaataagaaaaatag
TGTCTGCGGTGACAGCACAGTAGTTATTATTGTCGTTATCATGATCGTCATCACTGTGGT
TCTCGTCCAGCTCTGCCCTGCAGACAGCTGTGTAACCCTGG
gtgagtttcttgccagctctgtgctttactgcctcatctgtgaattgagcatagggggtg
cctagcaatttaaatgagataatagctcttttttttttttttttttttttgagatggagt
cttgctctgtctcccaggcaggagtgcagtggtgtgatcgtggctcactgcaacctccac

Exon  4 +      35609      35697   0    Initial     89    44    Marginal
aaaataataataataaaaataaaaagaaataaatgtcagtttagcgataaggactatcaa
gaaaaataaagaaggccaaaggaaaagaggctgatgggctgtgctggggaggtccctgaa
aggctgtctgaggacctgacatttgagctgagacctgagaagtgaggaggaaccagttat
ATGAAGAACTGGGGGAAGGCGTTCCAGGCAGAGGGCACAGCCCGTGCAAAGGCCCTGCGG
CAGGACACACCTGGCACTTTGGAGGAACA
gtgaggaggcctgtgtggctgcagcagagtgaggagaggaagagaaggaggaggggaggg
cagtttgtgcaaggcctggtgggcagtaggaaggacttgggctttgaccccaaggcaggt
gggagccatagagggctatgggcagaggagggaccagccctgactcaggtgctcacaggc

Exon  5 +      37378      37454   0    Initial     77    42    Marginal
aggcaatcactaacttcctctgaaggaaagaaaacagaaggctgagattgagggtagcca
gaggctgcttgaggtgaaggggctcagcgtagacctctctgagaagggagcatttgagct
gagaccaggagagatctcaagagagagcaagcagttagctgtttagacagagggaacaga
ATGTGCAAAGGCCCTGAGGCAGGACTGGGCCAGGTGCATTGGAGGAACAGCGAGGAGGCC
CCTGTGGCTGGAGCAGA
gtgagtgagggggagagagggaagaggggagggcagaaagcggacaggacaggttgtgca
gggcctgtggtcctagtcctccactttgactactcccccaaatctcttaatgttcctcac
attcctttccctgacaagcatttattttgcacctgctgtataccagatcctatcaggaga

Exon  6 +      59691      59762   1   Internal     72    99   Excellent
gggcagcagccaagggaagggcccaaagagagaccccagggcctgggtgtgttttggggc
cactgtttgtctccatagcactggcccagcccaggactggggccaccagcatcgacactt
catctgctcctggggtggggtctctgtgatgccaccagtgtttcttccctctctttgcag
ATGCAGAGCAAAGCGGCAGTCCCCGGACAGGGATGGGCTCTGACCAGGAGGACAGCAAGC
CCATCACGCTGG
gtgagtctgggggcagcgtggcggtgaagggcggagggcgcagccctgtcctcgtctttt
atttgggaatcatttgcttggcaccactcgttttacagatgagcagactgaggctcggag
aggttaaggggcctgtccaggggctaccagggagctgggttggaacccacgactctgagc

Exon  7 +      68103      68177   1   Internal     75   100   Excellent
acaaggaccccccacggggccttccccatcagactggagctgtcattcccccacagcaca
ggatggacagggggaacgtccaggctcgggccagcccccaggagtccaggcagccctgga
gtgtggggaagggaaacaggcccagctcagcctactgaccccgctgtcttcctgttccag
ACACGACCGACTTCCAGGAGAGCTTTGTCACCTCCGGCGTGTTCAGCGTCACTGAGCTCA
TCCAAGTGTCCCGGA
gtgagtgttcccgtcagccctgagctgggtcttggagaggggagggggccgcagggagga
aggagcccacccccctcaccctactccttgtcctttccagacaaccccctgtgtcactaa
gccaaggttcctagaaagggaggtggccaggcccttcccagagcccaaggtcagggctcc

Exon  8 +      68862      68981   1   Internal    120   100   Excellent
ccatggccttggtcctctgatccatagaataaaactggtttcagccaccctaggaaccgg
gccaatatgggaagggggtccccctttggactgcacccagtggctttccctacctctcta
aagcaaaccgcagcactgggcactgcttcctgcctcactctcctctgtcaccctctgcag
CACCCGTGGTGACTGGAACAGGACCCAACTTCTCCCTGGGGGAGCTGCAGGGGCACCTGG
CATACGACCTGAACCCAGCCAGCACTGGCCTCAGAAGAACGCTGCCCAGCACCTCCTCCA

gtgggtaagtacccaggtccccacctctgggcatttcatgaccccattcatcaacccatc
ccctctggcccgagctgactcattcctctccctggaatacctcttttcacgattcacctg
gcctgagaaactcctactcatctcatccttcaaaacccagccagccccacgtgcctcttc

Exon  9 +      69643      69792   1   Internal    150    85        Good
gcccgggtgtcccatccaagcaatggacaggttggaacaggcgttcgtagggaacgggct
gaacgcccgcggctcccgcgatgtctcgcgatactacctccctcgcccccgctcacttaa
ggaccggaagtagcaaagcccgccgtcgcgccccccgccccgcgtctccctggtaaccag
CCTCTCCCCTTCCCTCGCCCATAAGGAGCAAGCGGCACAAATCGGGCTCGATGGAGGAAG
ACGTGGACACGAGCCCTGGCGGCGATTACTACACTTCGCCCAGCTCGCCCACGAGTAGCA
GCCGCAACTGGACGGAGGACATGGAAGGAG
gtagggctggtggcgggggcggagccggccttccggtctgagtcaccgtggcgggaacta
cgtcttccggcagccactgcgcgggcgccgcggggcaggaagccggcctggagccgcggg
gcctcctgggaattgtagtcgtcccgagctgcgcttggctggaagtacggtccgggttcg

Exon 10 +      83599      83724   1   Internal    126   100   Excellent
ctctgagccttcgtttactcctctgtgtaatgggctcacagcctctccccctcaggattc
tggggtaagaggaggcggggtgatgaggcttcctatcccttcggaggctggctttgggga
aggtccagggctcatggggtgtgaccagcctgtgactctctcgtcccatcccctccacag
GCATCTCGTCCCCGGTGAAGAAGACAGAGATGGACAAGTCACCATTCAACAGCCCGTCCC
CCCAGGACTCTCCCCGCCTCTCCAGCTTCACCCAGCACCACCGGCCCGTCATCGCCGTGC
ACAGCG
gtaagcgccacgggcccctggcggggaggggcggcgggccctcctatcaggcctctcaca
gccggggaagtcccactggatgtctgaccatgagtcctattgctgtagccttctaggtgg
gcaaaaaaccatagaggtgccgtagtggagagcgcccagggccttgttccagcccggctg

Exon 11 +      87132      87251   0   Internal    120    89        Good
tactaaacgcactgagatgccggcaggaatgacacccacagacacacagtcacacggtca
cagagcagaccggctggagcccccaagtaacccccgcttcccactgtctccgcagggatc
gcccggagcccacacccgtcctccgctctgcatttccctacgacgtccatcctaccccag
ACGGCCTCCACCTACTTCCCCCACACGGCCATCCGCTACCCACCTCATCTCAACCCCCAG
GACCCGCTCAAAGATCTTGTCTCGCTGGCCTGCGACCCAGCCAGCCAGCAACCTGGACCG

gtgagttgggcggggcgcattcgggcctctcctggcggctccaggtgacctcccgggggc
cacgtgctcacacgaaggcacaacctctgcttaaaagggtcttgaggacttggctctgaa
gtcccctcctctgtcgtgctgggaggcagctggattgggtcagaattgagatgctttcgg

--------------------------------------------------------------------------------