--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (11366 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        240        342   2   Internal    103    78        Good
cccggaactggcacaggccccgcccccgggagggccccgccccactagacctcggcgcga
ttggtcgctgaccccgctagaccccaccccagagggctgggtcgtgctctcctcaaaccc
aaacactaccaccggttccgggatcatgaaactccgcccctgagtttgggctcactctag
GATTGGACAAGATCTTGACAGCCACGCCCCCAGGCTGGCCACATCCTTTGGCGGCTCGCG
CAACTCAGGCTCTGGAAACAAGATTGGTCACACCTTCGATACT
gtcccctccctacttggaagctaacaccaggattggcccggactccgcgaaacagcaagc
ctgaccacgccccccgaacctgtggcctgtcaggggtagatccaggcacggcctcgcccc
ttcatcccttatacagtctcagattggtcaagtcccttttaggttatgcctccaattcta

Exon  2 +       1201       1297   0    Initial     97    87        Good
gcgcgtgcgcgcgatccatgtccatgtccgcgcctatcaataaagttgctcacttgttgc
cggcccgctagcccgaaaggttgcgcgcgcagcccgagaagtctcgcgatagccagccgc
ggctgcccttgcgcttcccgagctggcggggtccgtggtgcgggatcgagattgcgggct
ATGGCGCCGAAGGTTTTTCGTCAGTACTGGGATATCCCCGATGGCACCGATTGCCACCGC
AAAGCCTACAGCACCACCAGTATTGCCAGCGTCGCTG
gtgagcgccggccgggccccgagggtggagggccgaggccgcagggaggtcgtggggtta
ctgggggctgtttggatcgaacgggtctgggagtctcgcgggtacgcacgtggttgtcat
cggggtgtcttgggcggtcgtagggggggatcttgtgtgaaatggatgttggtagggggt

Exon  3 +       7912       8004   1   Internal     93   100   Excellent
gttttggagcagcaaacccgagttcaaatccagctctgccactcagcagccggggacact
atgggcaaagaaggggggcatcgtgaggactgagggagggagaccacccagtggggtgcc
cggccaagcaagggcttagcagcagtggggtctgaacagcctccctcctctgtctcgcag
GCCTGACCGCCGCTGCCTACAGAGTCACACTCAATCCTCCGGGCACCTTCCTTGAAGGAG
TGGCTAAGGTTGGACAATACACGTTCACTGCAG
gtgagcacgctgggctgggcatggctgggccctctcctggcacagccccagctctcagag
cacatttgacggctgcctcttctctctgactccccagcccgtgtccacagtgctggccat
ccggagaaagtggggtgttcctttatcaggaatacatgtagggtggggaggcccaggaga

Exon  4 +       8050       8456   2   Internal    407    58    Marginal
gcagcagtggggtctgaacagcctccctcctctgtctcgcaggcctgaccgccgctgcct
acagagtcacactcaatcctccgggcaccttccttgaaggagtggctaaggttggacaat
acacgttcactgcaggtgagcacgctgggctgggcatggctgggccctctcctggcacag
CCCCAGCTCTCAGAGCACATTTGACGGCTGCCTCTTCTCTCTGACTCCCCAGCCCGTGTC
CACAGTGCTGGCCATCCGGAGAAAGTGGGGTGTTCCTTTATCAGGAATACATGTAGGGTG
GGGAGGCCCAGGAGAACAGCTCCAGGACTGGGGCCAGGAGGCTGCCATGCACAGCGAGCA
GCCGACTCGTGGCATCTCTCTCCATCCAGACACTGGCAGTGAGCGCCCAAGAGGCTCCTG
CTGTGCCCGTCTCGAGGCCCTTGCTCTTCCCGTCTACCCCGCAGCTGCTGTCGGGGCCGT
GTTTGGCCTCACCACCTGCATCAGCGCCCATGTCCGCGAGAAGCCCGACGACCCCCTGAA
CTACTTCCTCGGTGGCTGCGCCGGAGGCCTGACTCTGGGAGCACGCA
gtgagtggccccctccccacccccaccctcctcccagcctggcagaatgacccctgacct
ctgctcatcctccaccctctctgttccatcccggacaagaagtaaagcagccttcttgaa
caccagccatttcagtcatagcgacagctgctgctgctgcttaagcacctactgtggccc

Exon  5 +       8334       8456   1   Internal    123   100   Excellent
gaatacatgtagggtggggaggcccaggagaacagctccaggactggggccaggaggctg
ccatgcacagcgagcagccgactcgtggcatctctctccatccagacactggcagtgagc
gcccaagaggctcctgctgtgcccgtctcgaggcccttgctcttcccgtctaccccgcag
CTGCTGTCGGGGCCGTGTTTGGCCTCACCACCTGCATCAGCGCCCATGTCCGCGAGAAGC
CCGACGACCCCCTGAACTACTTCCTCGGTGGCTGCGCCGGAGGCCTGACTCTGGGAGCAC
GCA
gtgagtggccccctccccacccccaccctcctcccagcctggcagaatgacccctgacct
ctgctcatcctccaccctctctgttccatcccggacaagaagtaaagcagccttcttgaa
caccagccatttcagtcatagcgacagctgctgctgctgcttaagcacctactgtggccc

Exon  6 +      10055      10167   1   Terminal    113   100   Excellent
gtgcatcagtttccacatctccagagtctagggccctcttcctgagtgacttaatccctg
aagagagtgtcctgtcaggggtctcagtctggctcccagggtgggcaccggccagggcgt
ggagcgtcttggtccggccgagccccacccgggcctgacatcacctccccactcccacag
CGCACAACTACGGGATTGGCGCCGCCGCCTGCGTGTACTTTGGCATAGCGGCCTCCCTGG
TCAAGATGGGCCGGCTGGAGGGCTGGGAGGTGTTTGCAAAACCCAAGGTGTGA
gccctgtgcctgccgggacctccagcctgcagaatgcgtccagaaataaattctgtgtct
gtgtgtgtgtcagtgtccggagggcttgatgacggcgacacagcagccggtgagggcgga
tctgggagggagtgaggaagggagataagataaggccccctgcacacgcgcctgcctgcc

--------------------------------------------------------------------------------