--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (29769 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (12 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1271       1330   0    Initial     60    97   Excellent
cgttacgaggccgctggttggccagcgctagtcacgtggttcctggccgcaagcgacgcg
cgccggtgcgacgtcaacgcagccgggcgagttttaccgatctgtgttccgcggcccggc
cgcggctgagtcttcccagggtcagggtcaggcgctttgctgagtccctttgtggccgcc
ATGGACAATTCCGGGAAGGAAGCGGAGGCGATGGCGCTGTTGGCCGAGGCGGAGCGCAAA

gtgaagaactcgcagtccttcttctctggcctctttgggtgagaaccgggctgaggggtc
ggccgggacctaggctgagaggacgaaggagtcacgctcggaggtggcgggttagggcac
gcagagctcgggccgaggggacggagaggaacctgcaataaggtgacatggcctgaggcg

Exon  2 +      15485      15578   0   Internal     94   100   Excellent
ggcctcggtctgggctcgctcaggtcaccctcgtcctgtcttggggactctttccgcatt
ctcgagagcccgacccacctcccagggcagtgtctctgtggcttcataaagtgtggagcc
ccactgaggccaggactgcccttctcttctgttccagctgctggaaacgcgttctgccag
GCTGCACAGCTGCACCTGCAGCTCCAGAGCAAGCACGACGCAGCCACCTGCTTTGTGGAC
GCTGGCAACGCATTCAAGAAAGCCGACCCCCAAG
gtgagggcctctgcgggccacacgggctggctgtccggagcgccatcctagcaccctgca
ttgattcctcaggtttcctggcggctctggtttttccagtggccgacatgtgataggctg
gcaggggcgtgcctgaggcagagtgagcgttgactttagaactggctctcttccttccag

Exon  3 +      17130      17165   0   Terminal     36    90   Excellent
cgaacagagagtgccatttgctctttcagcagacccctcacttcctgcagacaggccctg
cctggcagtgggatatggtggggtccctcccctgcgtttgatctgagcttttctagctct
ccagcgagactctgcagggtgtgggcctggagtctggatgtggcccctccctggccttag
GAAGCTCAGAAGGTGGCTGAGGACTCCGACCGGTAG
gaaagtataaagatgatgttacatccagggcacagaggccaacttgcacagagctgaggc
tgggggcgtgaatttggctatgggagatctttcaaggaagaaagggggcagttctgaaag
gagagcctcacctgggtagagctgagagcaggtgccgtgtccagagccctggggacgtgg

Exon  4 +      20615      20661   1   Internal     47    95   Excellent
ctcagggattccgtccccttcttcccagccccttgagagtgtgtggcagcgctggcagct
ctgagcgcctattgatctctctgctggcagccaggtgcgcctgcgtccgcctcctctcct
cagcttctgctgaaacgacttcactttctcatgtctcctcccacctccctttctctccag
AGGCCATTAACTGTTTGATGCGAGCAATCGAGATCTACACAGACATG
gtaagggctgcttgcttgtcctgacacccccgggtcccactgcattgccccagccttgcg
tcccctctttcagcacccccagcactgttcttattctgcggccaaaccacttggggaggg
ggaagtgggagctggggggattaggtcacctgagctggcctgggctggctgggtcttcac

Exon  5 +      22718      22795   0   Internal     78   100   Excellent
tggggccctcccttctcactcctgtgttcccccacctctcgatcttcttcacacctcagg
tcttcttcatacctcctcacaggcgtggctgaggggtgggaacttgaagggtcataggtc
agcaggcaggcacgcaggaggtcatgagtcgcaggcagccccttcctgtgtcccctccag
GGCCGATTCACGATTGCGGCCAAGCACCACATCTCCATTGCTGAGATCTATGAGACAGAG
TTGGTGGACATCGAGAAG
gtgagtggcagcagggccctgcatgggctggcagccaggaccagtgctgctctctcttct
tcccaccaggggagtcctctggtgtctgagtgccgagaagggggcatggggcgccggcag
agcttggagaatggggtctggctgtgtcccaggcaggcagggcggagggtgtggaagctt

Exon  6 +      23037      23092   0   Internal     56    92   Excellent
cccaccaggggagtcctctggtgtctgagtgccgagaagggggcatggggcgccggcaga
gcttggagaatggggtctggctgtgtcccaggcaggcagggcggagggtgtggaagcttc
acggaggcctcctctcccttccctgccctcccctggaacccatcccccgtgtctccccag
GCCATTGCCCACTACGAGCAGTCTGCAGACTACTACAAAGGCGAGGAGTCCAACAG
gtagcccccttcctgcctgccccagccccgcagggaccgccaccacttcccctcactact
cctccccacacagctcagccaacaagtgtctgctgaaggtggctggttacgctgcgctgc
tggagcagtatcagaaggccattgacatctacgaacaggtggggacaggtggggatggcg

Exon  7 +      23166      23250   2   Internal     85    93   Excellent
tcctctcccttccctgccctcccctggaacccatcccccgtgtctccccaggccattgcc
cactacgagcagtctgcagactactacaaaggcgaggagtccaacaggtagcccccttcc
tgcctgccccagccccgcagggaccgccaccacttcccctcactactcctccccacacag
CTCAGCCAACAAGTGTCTGCTGAAGGTGGCTGGTTACGCTGCGCTGCTGGAGCAGTATCA
GAAGGCCATTGACATCTACGAACAG
gtggggacaggtggggatggcggcttccaccctgccccctctcagggcctgtgcctcctc
ctaagccccggcaccttgttctggaaccacccctcccccggctcaccctctgcctctccc
ccgacatcccttgccatgtcatccccccaccctgtcttcagcctggctgaatgttctcca

Exon  8 +      24092      24196   0   Internal    105    97   Excellent
gcactggccgctgacctctccaagctggtccctggctccctgcccttggggtcctgggtt
aacagggcctcacctcgggacatgaaccagctcccagctggccccccagtgcctggcagt
ggctctggccctctggctgcttgccctgagctcaccagtgccacttctccatggctacag
GTGGGGACCAATGCCATGGACAGCCCCCTCCTCAAGTACAGCGCCAAAGACTACTTCTTC
AAGGCGGCCCTCTGCCACTTCTGCATCGACATGCTCAACGCCAAG
gtagcacaccccacgcccgcaggaccaccgcaccaggccaccatgtgcttatctccaggc
caggtcccgttgcccccgaagagggacgtgctcctccctcacgtctggcccctgccagcc
agcctttggatgagaagtgtggttctcacagctgtgtttctgtgctggcatcacctgccc

Exon  9 +      25152      25216   2   Internal     65    91   Excellent
cctcactttgaaaagggggctcaccgtcatttgaccctctcagggtcctcaagaagcacc
agccccaggcctggcatggaggatgtgctcatttgtcccctgccccagctgagccaggtg
ggaggaggcagtgggtgcctatctggggaaccttccccctccacccacctctccctgcag
CCATCTCTGCAGCCAGGCTGGTGCTGAGCTCAGCTACGGGAAGGTACTGACAGACACAGA
GCCAG
gtgacacctgaggctgggggaggggtgcaagagctgactcaatatcacccgacatcccca
agtcccctcagctgctaggccagtagctctgaggaccctcttgttactaactcatcttct
cccttccctgctgcccagctggctgtccaaaagtatgaggagctgttcccagctttctct

Exon 10 +      25355      25423   0   Internal     69   100   Excellent
ctgagctcagctacgggaaggtactgacagacacagagccaggtgacacctgaggctggg
ggaggggtgcaagagctgactcaatatcacccgacatccccaagtcccctcagctgctag
gccagtagctctgaggaccctcttgttactaactcatcttctcccttccctgctgcccag
CTGGCTGTCCAAAAGTATGAGGAGCTGTTCCCAGCTTTCTCTGATTCCCGGGAATGCAAG
TTGATGAAA
gtaagtgctgggtgctccggcctcccccttcccgaacctcagacgggggtggctggggct
ccaggtgggacaatcgccaagacttgtccagtagttctcagagggtgtctttgttttgtt
ttgttttgttttgttttgtttggccatttgagtctccattttccagatgaagaaagtaca

Exon 11 +      26450      26500   0   Internal     51   100   Excellent
agcaggatcgcaacacgcccgtacccatccccagtttaacccacacggattgaccctctg
agagtcctcaggaagccccagccccaggcctggcatacagatagcgtgtcctttcatcta
atccaggccagacctcaggtcagcataggcccctgacccctctctgccatttgcttgcag
AAATTGCTAGAGGCCCACGAGGAGCAGAATGTGGACAGCTACACCGAGTCG
gtgagtggccagcatggggggccaggccccttcacggggatgggtctcctaggaaagctg
cccttctcagacacgctctccatgacattcacccatttcatctggcccccagcccactgt
gaagttctttctccagtcaccccagaaaccttacaagtagcgccaagaggcgcagggagt

Exon 12 +      27822      27923   0   Terminal    102    94   Excellent
gtcaagacagacaagagggagctcccatggctgagttggggcctcaagccctccctctac
tcctcctcagagaccaggggtgacagagacagatcttgaaaaccttgggacaagtgccct
tgggctgcagggttgggaacggggggagcatggccagcctatcacctggtgtgccctcag
GTGAAGGAATACGACTCCATCTCCCGGCTGGACCAGTGGCTCACCACCATGCTGCTGCGC
ATCAAGAAGACCATCCAGGGCGATGAGGAGGACCTGCGCTAA
gccccacccagccccccagtgcccgtcttcctgtcccatctgctcagagagaggtggggc
cgagacttgctggagagcttccctcctttcccatctggggagtgccgcgggccacagtgg
gcaggtggcaccgggggtcagcatgcaggggcgccagaggcccaggctgctggccggaca

--------------------------------------------------------------------------------