--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (9521 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1192       1274   2   Internal     83    55    Marginal
ccacaacctctccacacccccagcactcctcctccattcagtcaagctctggcccagcaa
gccgccagttcatcccaaaaggggggtccccctgcacttacctcctctcccaaggcccct
gtcacagccccagggcttccccctcccccaggtacatttcccaaccccgattaatcacag
GGGCGGCCCCATGGAGGAGGAAGGAGATGGCATGGCTTACCATAAAGAAGCACTGGACGC
CGGGTGCACGTTCCAGGATCCAG
gtgcccaggggtcatgaagctgggactcctctgtgctctgctctctctgctggcaggtga
ggctcccaggctggctgccccttcacggctgtactaaggtcaccttgctcttccctccca
tcccaggcttctgcctcctgccctctaggcttctcagcatcctctccctgccctcccagc

Exon  2 +       1496       1652   1   Internal    157   100   Excellent
tctctctgctggcaggtgaggctcccaggctggctgccccttcacggctgtactaaggtc
accttgctcttccctcccatcccaggcttctgcctcctgccctctaggcttctcagcatc
ctctccctgccctcccagcctgctcttcgctgacccctttgtccctcatccccaccccag
GGCATGGCTGGGCAGACACCCGTGCCATCGGGGCCGAGGAATGTCGCCCCAACTCCCAGC
CTTGGCAGGCCGGCCTCTTCCACCTTACTCGGCTCTTCTGTGGGGCGACCCTCATCAGTG
ACCGCTGGCTGCTCACAGCTGCCCACTGCCGCAAGCC
gtgagtgacccaggctggccatgctggggagggacagaggctgggggtcaggagagggtg
aggggtgctttaggccagaagtgcggagcctccacttctgataccacaagttcaactctt
agaagtaggaagggtagcctcccaaatcctaaaattctagagaccagcaatatctcattt

Exon  3 +       3201       3273   1   Internal     73    71        Good
ggaatccacctgatgcaggaatcctctctccattgcctctgaaaagtgaccatccatact
gttccaattttcttccctccatgagtaaagcactgattgtggtaagagatgctgtgtggg
aatttcccatcatgcattgctccatgatggaacctcctttaacttaagcctatacatcag
ACTGGGAGAACGATGTTCAGATTTCAGCCGAAAGTGAAGCAGGAGAAATGCAGAGATATG
AAGGTGGAAGAGA
gtgagaggcaggggaagggtagggggatgaagggatgtaggggtgaggactacttttcca
gatccagagccaagacagcaagaatgacagagagagacagacacagatgtttctggttcc
ccaaccctgaattcgcagtcattagcctgctgcctaatgtcagaggtcagaggctgggga

Exon  4 +       4112       4377   2   Internal    266    82        Good
ggaggtgtgtgcctcgcttaaaatcacagtaccctgggccagacatagatgatgagggtg
cagagagggtgtgtggcttgcagagggtcacacagcaccctgatggacaggaaaagaggg
ctggggctgaaaggacttttacctttcccccagcttgacctctgaggcctgtcccagcag
GTATCTGTGGGTCCGCCTTGGAGAGCACCACCTCTGGAAATGGGAGGGTCCGGAGCAGCT
GTTCCGGGTTACGGACTTCTTCCCCCACCCTGGCTTCAACAAGGACCTCAGCGCCAATGA
CCACAATGATGACATCATGCTGATCCGCCTGCCCAGGCAGGCACGTCTGAGTCCTGCTGT
GCAGCCCCTCAACCTCAGCCAGACCTGTGTCTCCCCAGGCATGCAGTGTCTCATCTCAGG
CTGGGGGGCCGTGTCCAGCCCCAAGG
gtatgacctggcccagaactctctctgaaacttgctccctcacccctctgtctctgcctt
ttcatctctgtcttctccttttctctctcctctctctctctgtcagtctatctatctgcc
aatcgatatatttaaccaaatataagatgctagcatttttaagatgtgccattatttcat

Exon  5 +       6995       7131   1   Internal    137    89        Good
catttgtttctcttgtgtgctatgactgtctgtctgtcactgtctcttgtctctatcttt
gagagtcctaaatgtggctccattggtcctttggaaaagctgcagggaggactcagggca
gtggggtgctgagtgtgttggagacagttgcagatccttgacagttctcttccctgacag
CGCTGTTTCCAGTCACACTGCAGTGTGCCAACATCAGCATCCTGGAGAACAAACTCTGTC
ACTGGGCATACCCTGGACACATCTCGGACAGCATGCTCTGTGCGGGCCTGTGGGAGGGGG
GCCGAGGTTCCTGCCAG
gtgagaccttactctggggaaaatgaggctgtcctgccaagttttctaggatttagggga
gcagaggggtcggcccccagccttcctgggtcaaaatgagaaggagactgggatacctgg
ttcctgggagaggacgggaccagggcctggactccttagtgtaaaagagaaaaggtctgg

Exon  6 +       9126       9205   1   Terminal     80    81        Good
ggcccccagcctcctcccctctcagaactaaaatcttggcccccagccctttatgtttca
gatcgtagagtctcagcaccgagtccctcctctccctagcctcaggagtctgagattcca
gcccctcctccctcaagatttcacgttcaatcccctccgccccttctcactcacacccag
TGTTCCAGTTCCCAGAAGCTCCCCAGGCTCTAGTGCAGGAGGAGAAGGAGGAGGAGCAGG
AGGTGGAGATTCCCAGTTAA
aaggctccagaatcgtgtaccaggcagagaactgaagtactggggcctcctccactgggt
ccgaatcagtaggtgaccccgcccctggattctggaaggtgaggtgcagaggtactcaga
tacagacatcaggccccggaccctccttctccagattccaggaccccagcctcagatgcc

--------------------------------------------------------------------------------