--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (4718 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (4 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1264       1350   0    Initial     87    81        Good
tgaagtttgtgccccagaaacagtgcccccccgccgccttgccttgctttgccttatcag
aggctgcagccaatcagctaaggacagagaggagccctcgaaggggctatcacagcctca
gagttcacgaggcagccgaggaagaggaggcttgaggcccagggtgggcaccagccagcc
ATGGCCACAGCCGAGACCGCCTTGCCCTCCATCAGCACACTGACCGCCCTGGGCCCCTTC
CCGGACACACAGGATGACTTCCTCAAG
gtggggcctagaaggtggggtctaggtgggctggctggaatccagggccacagtcacaga
tcttggggtccagacctgcatcttgacctgaaatcaagagacttaaccaggactgaggta
cgctcagtccaggagaggagatctcagcttagtctggcagggggtgaggagggtggtcta

Exon  2 +       2214       3113   0   Terminal    900    64    Marginal
agtcttatctcctgtctccagccagacctgatcggtttctgtccctggagctgggggggg
agcggggagaggggcggttagaggggcagtgttggggaagtgggacagacagacaggcaa
acaagacccctttccaaagcctctgcgtcagagtgtccagcccgcgatgtccctgggcag
GGCACCCCAGTGTCCACCGAACCTCGAGCTGCCTGCTCCCTCCCGCAGTGGTGGCGCTCC
GAAGAGGCGCAGGACATGGGCCCGGGTCCTCCTGACCCCACGGAGCCGCCCCTCCACGTG
AAGTCTGAGGACCAGCCCGGGGAGGAAGAGGACGATGAGAGGGGCGCGGACGCCACCTGG
GACCTGGATCTCCTCCTCACCAACTTCTCGGGCCCGGAGCCCGGTGGCGCGCCCCAGACC
TGCGCTCTGGCGCCCAGCGAGGCCTCCGGGGCGCAATATCCGCCGCCGCCCGAGACTCTG
GGCGCATATGCTGGCGGCCCGGGGCTGGTGGCTGGGCTTTTGGGTTCGGAGGATCACTCG
GGTTGGGTGCGCCCTGCCCTGCGAGCCCGGGCTCCCGACGCCTTCGTGGGCCCAGCCCTG
GCTCCAGCCCCGGCCCCCGAGCCCAAGGCGCTGGCGCTGCAACCGGTGTACCCGGGGCCC
GGCGCCGGCTCCTCGGGTGGCTACTTCCCGCGGACCGGGCTTTCAGTGCCTGCGGCGTCG
GGCGCCCCCTACGGGCTACTGTCCGGGTACCCCGCGATGTACCCGGCGCCTCAGTACCAA
GGGCACTTCCAGCTCTTCCGCGGGCTCCAGGGACCCGCGCCCGGTCCCGCCACGTCCCCC
TCCTTCCTGAGTTGTTTGGGACCCGGGACGGTGGGCACTGGACTCGGGGGGACTGCAGAG
GATCCAGGTGTGATAGCCGAGACCGCGCCATCCAAGCGAGGCCGACGTTCGTGGGCGCGC
AAGAGGCAGGCAGCGCACACGTGCGCGCACCCGGGTTGCGGCAAGAGCTACACCAAGAGC
TCCCACCTGAAGGCGCATCTGCGCACGCACACAGGTGAGGGGGCGGGGCCCCGGACATGA

gaaagggcgcggcgcccgctgtagttacaggggaagaagggttgcagagggcgggacttg
gacttggctggcctctgagagtgagtgcctccttaaattttgtgccctaggggcctcact
ttgttcatcctagtcccagcccaggctgagtaaaggggtgtggccagatgcaggggaccc

Exon  3 +       2262       2540   0   Internal    279    72        Good
agctggggggggagcggggagaggggcggttagaggggcagtgttggggaagtgggacag
acagacaggcaaacaagacccctttccaaagcctctgcgtcagagtgtccagcccgcgat
gtccctgggcagggcaccccagtgtccaccgaacctcgagctgcctgctccctcccgcag
TGGTGGCGCTCCGAAGAGGCGCAGGACATGGGCCCGGGTCCTCCTGACCCCACGGAGCCG
CCCCTCCACGTGAAGTCTGAGGACCAGCCCGGGGAGGAAGAGGACGATGAGAGGGGCGCG
GACGCCACCTGGGACCTGGATCTCCTCCTCACCAACTTCTCGGGCCCGGAGCCCGGTGGC
GCGCCCCAGACCTGCGCTCTGGCGCCCAGCGAGGCCTCCGGGGCGCAATATCCGCCGCCG
CCCGAGACTCTGGGCGCATATGCTGGCGGCCCGGGGCTG
gtggctgggcttttgggttcggaggatcactcgggttgggtgcgccctgccctgcgagcc
cgggctcccgacgccttcgtgggcccagccctggctccagccccggcccccgagcccaag
gcgctggcgctgcaaccggtgtacccggggcccggcgccggctcctcgggtggctacttc

Exon  4 +       3610       3861   0    Initial    252    57    Marginal
acggggcagcgccccttccgctgccagctctgcccacgtgctttttcgcgctctgaccac
ctggccttgcacatgaagcgccacctttgagccctgccctggcacttggactctcctagt
gactggggatgggacaagaagcctgtttggtggtctcttcacacggacgcgcgtgacaca
ATGCTGGGTGGTTTTCCCACGAATGGACCCTCTCCTGGACTCGCGTTCCCAAAGATCCAC
CCAAATATCAAACACGGACCCATAGACAGCCCTGGGGGAGCCTCTTACGGAAAATCCGAC
AAGCCTTCAGCCACAGGGAGCCACACAGAGATGTCCAAACTGTCGTGCAAACCCAGTGAG
ACAGACCGCCAAATAAACGGACTCAGTGGACACTCAGACCAGCTCCCAGATGGCCCTGGA
CAGCAGGAGAGG
gtgtgggatgaggcttcccagagaccctgggtctagaaagcggctcctgaaggtccctta
ttgtggctgatattaactgtcaatggttatgggtcctataaaaatgcccctcccagataa
agcttcagcgttggcctgaatttttgggttttggaggctggaagatggcaggaggctgta

--------------------------------------------------------------------------------