--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (8496 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1239       1385   1   Internal    147    68    Marginal
tgttacccaaagaatgataaagttggttttatttcaagaagtcgatcaaaaagaaagccc
cagcgctctagagctcagctgacgggaaagggggtgcgcagcctcgagtttgagagctac
ccggagctccaagacaggggtgggttccagctgcccgcacgccccgaccttccatcgtag
GTAACGCGGAAGAGCCCGGGAGAGCGTTGGTGGCGTCCGAGAGCGAGGAGCGGGAAAGAG
GATGGGTCTGCACGGAGAGTGGAAAGGCAGGCTGTGTACTCTGGGGAAAGTGGAGCAAGG
AAGGAGCTACAGTGGCCGACGCTGGAG
gtcggctgcagaaaaactagaaaaagtagggaggaaagaggaaaagaggaggcgtctaca
ctgagggggttctagagagggaggggtggactccgtagatgggggtagttcagtctcgaa
acctggggcgtgctctgtcctggaggagggaggcgggcagtcggaggggaattgaatgga

Exon  2 +       2023       2195   1   Internal    173    88        Good
ttagagagcctctcgggaggatgggaggatgggaagaggaggtttcctgtttgtaccccc
gaaaatatgggtgaaggacctgtgccgtggcccgtgagaaggaggtctgggtgcggaaac
tccaggccaggtgggtccgggggaggccggtcgcgcccaggaaatgccctatacgcgcag
GCCGGACCATGGGAACCCCAAAGCCACGGATCCTGCCCTGGCTGGTGTCGCAGCTGGACC
TGGGGCAACTGGAGGGCGTGGCCTGGGTGAACAAGAGCCGCACGCGCTTCCGCATCCCTT
GGAAGCACGGCCTACGGCAGGATGCACAGCAGGAGGATTTCGGAATCTTCCAG
gtgcgtgcgacgacctgggacgctggaaacccggagctgcgcgctgggcggaaaggactc
ctagtgggcccggctgagaaggcggaggtggcgcgcgaggggcgggctcgtgccaacgct
ggtgggtggggctagaacgggaggggcggggctagccggatccgctgactgatggtgggg

Exon  3 +       3355       3516   0   Internal    162    84        Good
ttgaaaactagaggtgggggatggaggtaggtgggacggggggatttggggatggacctt
gcagagttagaacttgccagggaaagagggtggtgttaggactcgggagacagggttagg
gccccaggagcaggatctaagtcgtcctcccccaccatcctgacaccactgttgccccag
GCCTGGGCCGAGGCCACTGGTGCATATGTTCCCGGGAGGGATAAGCCAGACCTGCCAACC
TGGAAGAGGAATTTCCGCTCTGCCCTCAACCGCAAAGAAGGGTTGCGTTTAGCAGAGGAC
CGGAGCAAGGACCCTCACGACCCACATAAAATCTACGAGTTT
gtgaactcaggtctgccagcttggggttcgtgtgggaggctggggccccaagggttcctg
gcactcctactcccctcaccacttttctcaacaggagttggggacttttcccagccagac
acctctccggacaccaatggtggaggcagtacttctgatacccaggtgagaatgtgccca

Exon  4 +       3611       3681   1   Internal     71    95   Excellent
gctctgccctcaaccgcaaagaagggttgcgtttagcagaggaccggagcaaggaccctc
acgacccacataaaatctacgagtttgtgaactcaggtctgccagcttggggttcgtgtg
ggaggctggggccccaagggttcctggcactcctactcccctcaccacttttctcaacag
GAGTTGGGGACTTTTCCCAGCCAGACACCTCTCCGGACACCAATGGTGGAGGCAGTACTT
CTGATACCCAG
gtgagaatgtgcccaactttcatgcccctcagtctccgacctgtctccatgggccttgtc
ctctccctctagacgatccccccactcccctgcctccagcctgcccctcacctgagccag
tgctgaccctgtctgtccctgccccggtctcctcaggagaaaattccaagtcttcaccca

Exon  5 +       4252       4444   0   Internal    193    95   Excellent
cgttcattagtgtttgtttggctgttgatgccatggctggctctgtccccaggctggaag
ccccttgaaggcagagctcaagcctgacctccctgcgttgctgagaacagacctggtcca
tatgaagtctccagaaaaggatatggaaatgcctgattctctttttttgtttccctccag
GAAGACATTCTGGATGAGTTACTGGGTAACATGGTGTTGGCCCCACTCCCAGATCCGGGA
CCCCCAAGCCTGGCTGTAGCCCCTGAGCCCTGCCCTCAGCCCCTGCGGAGCCCCAGCTTG
GACAATCCCACTCCCTTCCCAAACCTGGGGCCCTCTGAGAACCCACTGAAGCGGCTGTTG
GTGCCGGGGGAAG
gtgagtgtcagctgcaggctgggagggctgaggtctgggcggcagcccctgattctcaac
ccctctccccttcatgccgctgctgccgctgctcagagtgggagttcgaggtgacagcct
tctaccggggccgccaagtcttccagcagaccatctcctgcccggagggcctgcggctgg

Exon  6 +       4541       4635   1   Internal     95    79        Good
gccccagcttggacaatcccactcccttcccaaacctggggccctctgagaacccactga
agcggctgttggtgccgggggaaggtgagtgtcagctgcaggctgggagggctgaggtct
gggcggcagcccctgattctcaacccctctccccttcatgccgctgctgccgctgctcag
AGTGGGAGTTCGAGGTGACAGCCTTCTACCGGGGCCGCCAAGTCTTCCAGCAGACCATCT
CCTGCCCGGAGGGCCTGCGGCTGGTGGGGTCCGAA
gtgggagacaggacgctgcctggatggccagtcacactgccagaccctggcatgtccctg
acagacaggggagtgatgagctacgtgaggcatgtgctgagctgcctgggtgggggactg
gctctctggcgggccgggcagtggctctgggcccagcggctggggcactgccacacatac

Exon  7 +       4541       4921   1   Internal    381    74        Good
gccccagcttggacaatcccactcccttcccaaacctggggccctctgagaacccactga
agcggctgttggtgccgggggaaggtgagtgtcagctgcaggctgggagggctgaggtct
gggcggcagcccctgattctcaacccctctccccttcatgccgctgctgccgctgctcag
AGTGGGAGTTCGAGGTGACAGCCTTCTACCGGGGCCGCCAAGTCTTCCAGCAGACCATCT
CCTGCCCGGAGGGCCTGCGGCTGGTGGGGTCCGAAGTGGGAGACAGGACGCTGCCTGGAT
GGCCAGTCACACTGCCAGACCCTGGCATGTCCCTGACAGACAGGGGAGTGATGAGCTACG
TGAGGCATGTGCTGAGCTGCCTGGGTGGGGGACTGGCTCTCTGGCGGGCCGGGCAGTGGC
TCTGGGCCCAGCGGCTGGGGCACTGCCACACATACTGGGCAGTGAGCGAGGAGCTGCTCC
CCAACAGCGGGCATGGGCCTGATGGCGAGGTCCCCAAGGACAAGGAAGGAGGCGTGTTTG
ACCTGGGGCCCTTCATTGTAG
gtgagtgagacaggggcttcgacctggccagtacaaagcagcctgcacagtggttaacaa
ctcaggattggccgggcacggtggctcacgcctgtagtcccagcactttgggaggctgag
gtgggcagatgacaagttcaggagttcgagaccagcctggtcaacatagtgaaaccccat

Exon  8 +       6041       6156   1   Internal    116    94   Excellent
accctgatgggagggagggagggagggaaggaggggactttccccaaacaagcagtcccc
tggtcgaggcagcagagggccttaggtcaggggaggtggtgggggttatcattcaagttt
acggggaagggtgggtagagggtcctcttctcatccctgactaggctcctgggcccccag
ATCTGATTACCTTCACGGAAGGAAGCGGACGCTCACCACGCTATGCCCTCTGGTTCTGTG
TGGGGGAGTCATGGCCCCAGGACCAGCCGTGGACCAAGAGGCTCGTGATGGTCAAG
gtgcctgcagacctgagtccctggggctgaaaggggtggccttacagagggaagaggttg
ctcccaggaactccaactcccagagggccctctaaaaaactgcaacttccaagatctctg
caataaccagtttttcatccccgggagctccttcccatggcctcacctgcagaacctgtt

Exon  9 +       7036       7221   0   Terminal    186    95   Excellent
tgtgtgtgtgtgtgtgtgtgtgtgtgtgtaaaactacaactcccagcagccctaggccta
tggttcatcctaggttacagcaggggctgcagggagttgtagtcctccaagccctgactc
ctaccttggtggacagtggctgggtgttttccctgactcctgtccccacttcccctgcag
GTTGTGCCCACGTGCCTCAGGGCCTTGGTAGAAATGGCCCGGGTAGGGGGTGCCTCCTCC
CTGGAGAATACTGTGGACCTGCACATTTCCAACAGCCACCCACTCTCCCTCACCTCCGAC
CAGTACAAGGCCTACCTGCAGGACTTGGTGGAGGGCATGGATTTCCAGGGCCCTGGGGAG
AGCTGA
gccctcgctcctcatggtgtgcctccaacccccctgttccccaccacctcaaccaataaa
ctggttcctgctatgatcacttgtgcgtgtctggtgttgggtgccctctgacccaatatg
gttgttattcccgctcagggtctcagtttacccatctgtgcagctatatacaactcaggt

--------------------------------------------------------------------------------