--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (6959 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        369        477   2   Internal    109   100   Excellent
ccctcccaggagccccgcttgtcccaccttccccggatactgaccccatcagaccctgcc
tcctcgggctcatgcactctcgctgcagccccgccgtcgggggtcaaaacgccctggggt
gggcttttgggggaggggagattcttgggacggggctgaccgcggtatccttggctccag
GCCGGCGGGCGGCAAGGCTCCGGGCCAGCATGGGGGCTTCGTGGTGACTGTCAAGCAAGA
GCGCGGCGAGGGTCCACGCGCGGGCGAGAAGGGGTCCCACGAGGAGGAG
gtgagagtccctgcgctgagctgggggaggccccgggctcccgccccagcctcgaagccc
cgccccaggctggatttgaattgcttgtggctccgcccacagcccattttcctctggaag
ctgagaccccgccccgtgccagctgccacgcccctgacaggtcctctgccactctaagtc

Exon  2 +       1060       1263   0   Internal    204    97   Excellent
cctctaacccaccgtgtcccgactgctgaccgggccctacctccatcttttccgggttct
tcctcccagctaggccccgcccccatccccgcccatacgcgttaggccccgcccatgccc
ctctgagccctgccccagtacgccaggcccccctcccaacgacgcagcccggttctgcag
CCGGTGAAGAAACGCGGCTGGCCCAAGGGCAAGAAGCGGAAGAAGATTCTGCCGAATGGG
CCCAAGGCACCGGTCACGGGCTACGTGCGCTTCCTGAACGAGCGGCGCGAGCAGATCCGC
ACGCGCCACCCGGATCTGCCCTTTCCCGAGATCACCAAGATGCTGGGCGCCGAGTGGAGC
AAGCTGCAGCCAACGGAAAAGCAG
gtgggcggggcggggcgccgagcagggctggcggggtccacggactaccccccagtagcc
ccgacccccaaaggattccacgtgcagggtttttccttcttcctggagaaatgcccaccc
ataaccaactttttttttttttttttttgtgagatggagtcttgctctgttgcccaggct

Exon  3 +       2217       2337   0   Internal    121   100   Excellent
aggtgggagctcggaggtccctgagcaacaggctgaggagccggttctgtctgcctggag
ggaatagggagctatagaaggttcaggagaggggagggtgctgtgaaagcagagtgataa
agactggatcctggcgttggaggcttcccctgcttcaagccttctggtgctgccccccag
CGGTACCTGGATGAGGCCGAGAGAGAGAAGCAGCAGTACATGAAGGAGCTGCGGGCGTAC
CAGCAGTCTGAAGCCTATAAGATGTGCACGGAGAAGATCCAGGAGAAGAAGATCAAGAAA
G
gtgggaggggtcgggcgcggtggctcacgcctgtcatcccagcactttgggaggccgagg
cgggtgtatcacctgaggtcagaccagcctggccaacatagtgaaaccctccccctctac
taaaaatacaaaaattacctgggcgtggtggcgggtgcctgtaatcccagctactcggga

Exon  4 +       2938       2984   1   Internal     47    50    Marginal
gggaaagatacatagccagacaggagtgaagggggctcactcggtacagcgatgggggat
gcccagacgcggggcactcaagtggggagctggagccggctgagcagcgctgacctaggg
tgcagggcgtggtccctggaggcctgggaggctgaccctgcccttcccctcccccgccag
AAGACTCGAGCTCTGGGCTCATGAACACTCTCCTGAATGGACACAAG
gtaagcgaccttcttcctctcaaagcacctgggggagaaaggtctggaggcttctagaac
cctgagtcagagccagtgctcgcccagatgtgtgcaagcaggggcggtgccactgcaccg
tgggatcgctgttgattgtactcccaccggggtgtcccaggagaccctcctaggcttggg

Exon  5 +       3230       3302   0   Internal     73   100   Excellent
gtcagagccagtgctcgcccagatgtgtgcaagcaggggcggtgccactgcaccgtggga
tcgctgttgattgtactcccaccggggtgtcccaggagaccctcctaggcttggggcaca
cccagagagcgtggctgcctcctaccaccagtaaattgccaccttgtcccttcgtcttag
GGTGGGGACTGCGATGGCTTCTCCACCTTCGATGTTCCCATCTTCACTGAAGAGTTCTTG
GACCAAAACAAAG
gtgagcggtaactgcgctcctgatgcgaactccgtgaaactgggtggtagaggggggcgt
gggccaggagggccccaagactgcaggaggcggatcgggaggttccctatgagcgtccag
gcgcacgctgtcgctccagaggctgatgtggagcaggaggcagagggcgcagtgagggaa

Exon  6 +       3569       3784   1   Internal    216   100   Excellent
gaggcggatcgggaggttccctatgagcgtccaggcgcacgctgtcgctccagaggctga
tgtggagcaggaggcagagggcgcagtgagggaaacctgggcaggggcacgtcccgggca
aaagcccggaggtaggggaaaggggaggcgcaggctttgaccccgctccccccggcgcag
CGCGTGAGGCGGAGCTTCGGCGCTTGCGGAAGATGAATGTGGCCTTCGAGGAGCAGAACG
CGGTACTGCAGAGGCACACGCAGAGCATGAGCAGCGCGCGCGAGCGTCTGGAGCAGGAGC
TGGCGCTGGAGGAGCGGAGGACGCTGGCGCTGCAGCAGCAGCTCCAGGCCGTGCGCCAGG
CGCTCACCGCCAGCTTCGCCTCACTGCCGGTGCCGG
gtgcgggccacgcccatctcccagtcccgccccggtcacccggccccgcccgcctccccc
cccctcctcccttccccccttcccctgtcgcccggcgccgcccatcgccccgtcccctct
tccccagtcacccggccccgcctatcgccccgccctcatcacccccagctccgcctcctc

Exon  7 +       4658       4790   1   Internal    133   100   Excellent
tcctcgccatcctcctgccccggcttaccttagcccaccctgcgccgctcctgcgctggc
ggtgtccggacctctgagcgcccgcgcgacccgccctgagtcaccccctaccgctgcccc
tggagcccccgccccgcgactccccggcaccctcgcctgaccttcccgcctgtcccccag
GCACGGGCGAAACGCCCACGCTGGGCACTCTGGACTTCTACATGGCCCGGCTTCACGGAG
CCATCGAGCGCGACCCCGCCCAGCACGAGAAGCTCATCGTCCGCATCAAGGAAATCCTGG
CCCAGGTCGCCAG
gtgtgtgccgggcgaggcggggcggggccggggttcaaggcccggatgtgcccgccctgg
ggttccccaggtccgcgagggctgctgggtgggactccgcagcttactagagatcacctc
ccggaggggcctacctgcggtcgcccctgatgcaccagtgctaggatggccatggagaac

--------------------------------------------------------------------------------