--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (7265 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1228       1504   0    Initial    277    84        Good
gggcccgacccacccctgcgcaccccgcggtgtcgccttcccgggaggctcgggttccca
gatccccttacccgggcgtctcggctgtcgcgccctgggccgggggaggggaggctgcag
gaagcggcggatccggcggcggcggcgagggcccgggtgggtggccgaacttctcccgcc
ATGGAGGGAGCAGCGGCCCGGGAGGCCCGGGGGACCGAGACCCCGCGCGCGTCTGCGCCC
CCGCCCGCGCCCTCGGAGCCCCCGGCCGCGCCCCGCGCCCGCCCGCGCCTCGTCTTCCGC
ACGCAGCTGGCGCACGGGAGCCCCACGGGCAAGATCGAGGGCTTCACCAACGTCCGCGAG
CTGTACGCCAAGATCGCCGAAGCCTTCGGGATCGCGCCCACCGAGGTAAGGAGCCCGGAC
ACCGGCGCCCAAGACCACCCGCCTGATGGGGTGAGGG
gtagggagcttggaccctggacgggagaccccagatccccggatcccagacgtcggggtg
gccgcctaatcgccggatctcagagacccagccctcagatcccggggtgccacactccca
ggggccccctttgcacgctctgcgcaaaagatgggcaggtcttaggactagcggacccct

Exon  2 +       2105       2310   1   Internal    206    99   Excellent
gaggtcccggggtatggagaggggtctccacctgctggaagtctccttctccctcctctc
tctgttctgggggtcccacgccctgccctttcccatgggctgggatcctggtcgctgggg
gcaggggcctgcgcagacagggtggctgcgtggggggatgcatgccctggctaactctag
GCTCCTTCTCCCCCGGGAAGATTTTATTCTGCACCCTCAACAGCCACAAAGTGGACATGC
AGAAGCTCCTGGGGGGTCAGATAGGCCTGGAGGACTTCATCTTTGCCCACGTGCGAGGCG
AGACCAAGGAGGTGGAGGTCACTAAGACAGAGGATGCTCTGGGGCTGACCATCACGGACA
ACGGGGCTGGCTACGCCTTCATCAAG
gtgcccgggagggggtgggcgggtggcttcctggggtccagcaactgccccccccactct
gggtcgacgtgggttctgcggattggaggcgggtggctggggttgccctgccagcgacgc
tggatccctgcagagaatcaaggaaggcagtatcatcaaccggatcgaggcagtgtgcgt

Exon  3 +       2444       2624   0   Internal    181   100   Excellent
tggggctgaccatcacggacaacggggctggctacgccttcatcaaggtgcccgggaggg
ggtgggcgggtggcttcctggggtccagcaactgccccccccactctgggtcgacgtggg
ttctgcggattggaggcgggtggctggggttgccctgccagcgacgctggatccctgcag
AGAATCAAGGAAGGCAGTATCATCAACCGGATCGAGGCAGTGTGCGTGGGTGACAGCATC
GAAGCCATCAACGACCACTCCATTGTGGGCTGCCGCCACTACGAGGTGGCCAAGATGCTC
CGGGAGCTGCCCAAGTCCCAGCCCTTCACCCTGCGCCTGGTGCAGCCCAAGAGGGCCTTC
G
gtgaggcgggtgggctggcgggagctcttcccgaagtgcgttctacggatgcctggggtg
gaggagggtcggggatgggacgggctggaaggttctaggtgcacccgctgcgtgccaagg
agctcctggcagggtatcagaaactcgtaggtagtttctattaatagattgttatggagt

Exon  4 +       5073       5257   1   Internal    185    62    Marginal
tttgctggggatgcgaagtgtggaatctcgaataggtctctggagacttgccgtacagat
gtaaggaggactttgaaggggaggaagattctagaaaggctcggctgttggcctcccagg
gtttacaaagatgtggctccacccagaacccatggccatccctcactctgttccctccag
ATATGATTGGCCAGAGAAGTCGGTCCAGCAAATGTCCAGTAGAGGCGAAAGTGACCAGCG
GGAGGGAGACCCTGCGGCTTCGTTCTGGGGGGGCTGCCACAGTGGAGGAAGCGGTGAGTG
AAGGGGAGGGGCTCTCCCCAGGCTTCTGCACCTTCAGCTCCTCCACTGAGTCAGTGCGGT
CTTGG
gtaagaacttctcctcggagcctcagtttctctgcctgcaaaatgggtcctcattgaaaa
gtggggcaatgatgttggtaccagcactactgactcgtgtgagggtccagtctactcttc
ccttaggggtgggggtcgggagggggctgggctggagggctccaaagcttttcacccctg

Exon  5 +       5461       5542   0   Internal     82   100   Excellent
cagtttctctgcctgcaaaatgggtcctcattgaaaagtggggcaatgatgttggtacca
gcactactgactcgtgtgagggtccagtctactcttcccttaggggtgggggtcgggagg
gggctgggctggagggctccaaagcttttcacccctgacttccctcccgtgtgcccccag
CCCAGTGAGTTTGAGGAGGAGGCATCTCGGAAGGTTGATGACCTGCTGGAAAGCTACATG
GGCATTCGGGACCCCGAGCTGG
gtaaggggccagggtaagccagggggccctggggggagggaagcctacgggaggaggcag
gggtcccagcgggaagttgggcgcggggagtgccctcactgacatcccctctggcacggc
ccgcagcgtccaccatggtggagacgtccaagaagacagcgagcgcccaggagtttgcac

Exon  6 +       5669       5820   1   Terminal    152    97   Excellent
ggaaggttgatgacctgctggaaagctacatgggcattcgggaccccgagctgggtaagg
ggccagggtaagccagggggccctggggggagggaagcctacgggaggaggcaggggtcc
cagcgggaagttgggcgcggggagtgccctcactgacatcccctctggcacggcccgcag
CGTCCACCATGGTGGAGACGTCCAAGAAGACAGCGAGCGCCCAGGAGTTTGCACGCTGTT
TAGACTCCGTCTTGGGCGAGTTCGCCTTCCCCGACGAGTTTGTGGTGGAAGTGTGGGCCG
CCATCGGCGAGGCCAGAGAGGCCTGTGGCTAG
tttgccctgggggggcccagcacagccccagcccggagcccagccccctgccccggccct
gctccagaacccagcccagatcggaggacaagttcctctctagaacccaatccaatttgg
agccccagcccaactccagaacccaacccttctctagaatccagcccagatctgaggcca

--------------------------------------------------------------------------------