--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (14218 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       2658       2768   0   Internal    111   100   Excellent
cagagagaaaccgggaaagacaggcagagatggggccatgtctccagaaagtgtggaaga
ggcagaaggacacccagggaaggaggagcggggaagacagaacagtacaggtgggaagcc
cggaggagggggctgtgtgtggaacagcagagggctcccccagcacccgctcccctgcag
ACCTATCTCCTCCTGCTGCTGCTGCTGAGCTCGGGACTCAGTGGGACCCAGGACTGCTCC
TTCCAACACAGCCCCATCTCCTCCGACTTCGCTGTCAAAATCCGTGAGCTG
gtgagcggcgctgccccggaccccctcatgtgatcccccttccccccactttttttttta
agtagagatggggtctctctccctgtgtttcccagggtggtcttgaactcctgggctcaa
gcgatcctcccaccttggcctcccaaagtgctggaattacaggcgtgagccactgtgctt

Exon  2 +       3112       3165   0   Internal     54    98   Excellent
cgtgagccactgtgcttaggggtgtcatccctttttaagggcaaggttctgtggcttctt
ctgggctccccctctcttggtcttgtccctctctctctggatctctgctgccacctctgg
gtccccacagttctgtttctcgctgttttcagccaggcctgatcctgttttctcccgcag
TCTGACTACCTGCTTCAAGATTACCCAGTCACCGTGGCCTCCAACCTGCAGGAC
gtaagtcatgttgggagggacctgggatggaggtggggaccacagactcaagatgctcca
ccgaggcgagtggataaccaggccctcccctccccaaacccaggaatcagagtcctcagc
ccctcctccctcagacccaggagccccggcccagcccctcctccctcagacccagcagcc

Exon  3 +       3390       3557   0   Internal    168   100   Excellent
gactcaagatgctccaccgaggcgagtggataaccaggccctcccctccccaaacccagg
aatcagagtcctcagcccctcctccctcagacccaggagccccggcccagcccctcctcc
ctcagacccagcagccccgtgcccagctcctccctcagacccgtgggttctcccctctag
GAGGAGCTCTGCGGGGGCCTCTGGCGGCTGGTCCTGGCACAGCGCTGGATGGAGCGGCTC
AAGACTGTCGCTGGGTCCAAGATGCAAGGCTTGCTGGAGCGCGTGAACACGGAGATACAC
TTTGTCACCAAATGTGCCTTTCAGGTCAGCCCTCAACTTAGGGGACAA
gtgaggggagggagatgccttcctacgaattagaagtaaagctccactaggccttattgg
cgatttggaccatagccacccaacgaaggtagagcgagaagcgccaccctgcagagccct
gttcctacagaacaacacgtccccaggcaccggtgatggggagcagtctggtcccattct

Exon  4 +       5876       6003   0   Internal    128    96   Excellent
cctgggcaacagagtgagactctatctcaaaaaaaaattaattaattaaataaataaact
ctgagagccagagctcactgggccctgttgctgggcatcgccagcagggaagggcctttg
gcctgcggaggggcggtggggggatgacgtggtggtgacgtctccctcccctgctcccag
CCCCCCCCCAGCTGTCTTCGCTTCGTCCAGACCAACATCTCCCGCCTCCTGCAGGAGACC
TCCGAGCAGCTGGTGGCGCTGAAGCCCTGGATCACTCGCCAGAACTTCTCCCGGTGCCTG
GAGCTGCA
gtgtcagcccggtaaaggcttccaggcacccccactccttcccctcctgtcctcacggcc
gctcctcctctctgcacagtgcatcccagaccccatctttctcatattggttgtgacaag
ggcaagcttattcctctttctggagctcagtttaccaattttttttttttttttttgaga

Exon  5 +       7265       7469   2   Terminal    205    94   Excellent
atttgtgacagtctgatgaggtaggtacaatgattatcctagttttacagatgagcaaac
tgaggcacagagaggccaagcagcccatccaaggtcacacagccagtggcagccaggcct
ctctttccttccttaccccagcccttctccttggtcacccagcctcctctttctccccag
ACTCCTCAACCCTGCCACCCCCATGGAGTCCCCGGCCCCTGGAGGCCACAGCCCCGACAG
CCCCGCAGCCCCCTCTGCTCCTCCTACTGCTGCTGCCCGTGGGCCTCCTGCTGCTGGCCG
CTGCCTGGTGCCTGCACTGGCAGAGGACGCGGCGGAGGACACCCCGCCCTGGGGAGCAGG
TGAGCAGGCTGGGAAGAGGGGGTGA
gggggccgagagggtggcccacttgtggctgacactttggggcccacaggtgccccccgt
ccccagtccccaggacctgctgcttgtggagcactgacctggccaaggcctcatcctggt
gagtccttcctgggctatggggcctggactttgtgtctgcaggttgggagggtcactagg

--------------------------------------------------------------------------------