--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (12505 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (8 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1100       1391   0    Initial    292    89        Good
ggggttgttgttacacccactgtatagatgaggaaactgaggcctggagcccttgagtta
cacagaaagtgatcggcagtgtggggaatcagtacagtggagactttgaggggctgtgta
ggattctgacccacatctctgccccccacttccagggccaattcctgtccccccagcagc
ATGGCATCGTGTGCTGAACCCTCTGAGCCCTCTGCCCCACTGCCCGCCGGGGTCCCACCG
CTCGAGGACTTCGAGGTACTGGATGGGGTTGAGGATGCAGAGGGTGAGGAGGAAGAGGAG
GAGGAAGAGGAGGAAGAGGATGACCTGAGTGAGCTGCCACCGCTGGAGGACATGGGACAA
CCCCCGGCGGAGGAGGCTGAGCAGCCTGGGGCCCTGGCCCGAGAGTTCCTTGCTGCCATG
GAGCCCGAGCCCGCCCCAGCCCCGGCCCCAGAAGAGTGGCTGGACATTCTGG
gtaaggagcaaaggtggatcagggtgcccttggccctggccctctcgtcccctgagcctc
atttccccatctgtgctgtgagggttggaagtcacgtggtcaccaccgtgatcaccagcc
agaggcaactactggagatgcttcacattgatgtactctatccactgactcacacacatg

Exon  2 +       1881       1973   0    Initial     93    48    Marginal
ttggcatttgtctgacacatgcttgggctctgaaaaatgtgtcctgagtgcacgccagcc
tgggcaacacagcgagaccccaacttccaaaacaaaaaatgtgttctggggtcaagtgga
tcagaggaatgttattttgttcagccttctggttggttcacagtagtgatagtattgtaa
ATGCTCAGAGCAATCCTACAAGAAGAAAACTACATGAGCCCCCACATGTTCCCCCCAACA
TACCCCATCACAGCAACTGAAAACAAGAGAAAT
gttagttttctgtggaagacgtcttgctactagtatagtactgatatctaatataccaaa
taatgctggtgcccatgcaaataataagatatcattaccactatcaattgtaataacaat
actgtagcaatagtttccaatcatattgacactgatggaacagaaatattactaaatatc

Exon  3 +       3350       3519   1   Internal    170   100   Excellent
cgtggggttccccactctggtggcagagtggccattggaagtttggtttgtgccccagtg
ttgggccagccccctctggacagctagtgggcagagctgagggtaggagtgggggctcag
gggagcgggtgcctgtttgagctgccaggtgacaggctgcatgtccctggaccctggcag
GGAACGGGCTGTTGAGGAAGAAGACGCTGGTCCCAGGGCCGCCAGGTTCGAGCCGCCCGG
TCAAGGGCCAGGTGGTCACCGTACATCTGCAGACGTCGCTGGAGAATGGCACACGGGTGC
AGGAGGAGCCGGAGCTGGTGTTCACTCTGGGTGACTGTGACGTCATCCAG
gtgcgggctggggcgggacagggcaggggcgaggggcgtgccttgctgggtctgagtctg
cctgacagctggctatccccacacaccccaggccctggatctcagtgtcccactcatgga
cgtgggggagacggccatggtcactgctgactccaagtactgctacggcccccaaggcag

Exon  4 +       3611       3699   0   Internal     89   100   Excellent
tacatctgcagacgtcgctggagaatggcacacgggtgcaggaggagccggagctggtgt
tcactctgggtgactgtgacgtcatccaggtgcgggctggggcgggacagggcaggggcg
aggggcgtgccttgctgggtctgagtctgcctgacagctggctatccccacacaccccag
GCCCTGGATCTCAGTGTCCCACTCATGGACGTGGGGGAGACGGCCATGGTCACTGCTGAC
TCCAAGTACTGCTACGGCCCCCAAGGCAG
gtgagagtcagccacccttaggtctctgcaggtctcaggagggggatgggtggagtgggt
gtacccctcggctcaccccatctacttgcccattttatagacaagaaactgaggctgggt
gaggtggctcacacctgaaatcccagcactttgggaggttgaggtaggaggattgcttga

Exon  5 +       4637       4854   2   Internal    218    97   Excellent
tcccgcagctccaaggcggcaagtcacttcccctgcactttactgaggagggaatgatgg
agggcagaggggagacagatcgggggcttgagccaagctcactccttcctagccagccca
gcgggtttaggggtcaccaggtctgagtgctgcccctgcctgctcccacccaactagcag
GAGCCCATACATCCCCCCGCACGCGGCCCTGTGCCTGGAGGTGACCCTGAAGACGGCTGT
GGACGGGCCTGACCTGGAGATGCTCACGGGGCAGGAGCGCGTGGCCCTGGCCAACCGGAA
GCGGGAGTGCGGCAACGCCCACTACCAGCGGGCGGACTTCGTCCTGGCCGCCAACTCCTA
CGACCTCGCCATCAAGGCTATCACCTCCAGCGCCAAAG
gtgaccgcctgggtcagatctccaccatctcccctgcaaaggtgtccactccgtgccaga
aacttccagccccagagagcctcagactcagaatattctagaatagcccagaatatgggt
agatccccaactgcccctaagctagggcctgttacagactcgtggtatatcccagaccag

Exon  6 +       5297       5469   1   Internal    173    95   Excellent
tcgcttgcttaagtctccatcttgtagcttcctcaggagagccccaggaaagcgtggccc
ttggtccggggttaaaattggggaaactgaggccagagaggcagcctccgcagaggggtg
ggtgccggggtgtctggtggcatggtgacggctgccgtggcgggcactgtctcccaatag
TGGACATGACGTTCGAGGAGGAGGCACAGCTCCTGCAGTTGAAGGTGAAGTGTCTGAACA
ACCTGGCGGCCTCGCAGCTGAAGCTCGACCACTACCGCGCAGCCCTGCGCTCCTGCAGCC
TTGTGCTGGAGCACCAGCCAGACAACATCAAGGCTCTCTTCCGCAAGGGCAAG
gtaggccacaccggggtgccaggccgggtcactcagcctggggtatacggggtggtcccc
aaccctgcatttgagaaaggcataggtatataagccagctgagctctgtggggtgcaggt
ggagaaactgaggcccagacgggtgcaggagtgtggcctggtcacaacaattcattggct

Exon  7 +       9723       9800   0   Internal     78   100   Excellent
ttctccatgttggccaggctgtttttattttattttattttttgagatggagtcttgctc
tgttgctcaagctggagtgcagtgacaccatcttggctcactgcaacctcctgggctgga
tttcttgaaggacaggcccaggtatgggtccagagtgatgccacccccttccccttacag
GTGCTGGCCCAGCAGGGGGAGTACAGTGAGGCCATCCCCATCCTGAGGGCAGCCCTGAAG
CTGGAACCTTCCAACAAG
gtgagcaggacaggggtgccctgggacttgctcggctgggaagtccctcctgcggtctgc
cccaggtctttcttgctgtggctctctgttgtgttcccacctgggcagtggcacggagta
ggtacctgaagggtcctggtcagcttgtgaagaccctcatgacggccacacaggcagtct

Exon  8 +      10275      10406   0   Internal    132    98   Excellent
ttggctccctaggagggatggggtcagcagccctgactttgctaagcccagaaaggggca
gatgggacccctgtgtcccaacagtcccaccacccaaacagcctagggtcccagtaaggc
agagcgccagtgatgacaggttggccgctgcgtgttctcagcttcccctgccttctgcag
ACGATCCACGCAGAGCTCTCAAAGCTGGTGAAGAAGCATGCGGCGCAGCGGAGCACGGAG
ACCGCCTTGTACCGGAAAATGCTGGGCAACCCCAGCCGGCTGCCTGCTAAGTGCCCTGGC
AAGGGTGCCTGG
gtgagctggggcacagaatgggcaggggctgtgtgcagggcacgcctagcagagggattt
tattttgcatacatggatgtcctcggagactgggccgtcctgggcgatgcaggggacgtg
gagagagcccagccctgtgtgatcatgagtggagtcgaaggtggaactcaagctggaggg

--------------------------------------------------------------------------------