--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (4383 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (3 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1201       1435   0    Initial    235    88        Good
tctgcatctatcccaaaaaacaagggtgttctgtcagctgaggatccagccgaaagagga
gccaggcactcaggccacctgagtctactcacctggacaactggaatctggcaccaattc
taaaccactcagcttctccgagctcacaccccggagatcacctgaggacccgagccattg
ATGGACTCGGACGAGACCGGGTTCGAGCACTCAGGACTGTGGGTTTCTGTGCTGGCTGGT
CTTCTGCTGGGAGCCTGCCAGGCACACCCCATCCCTGACTCCAGTCCTCTCCTGCAATTC
GGGGGCCAAGTCCGGCAGCGGTACCTCTACACAGATGATGCCCAGCAGACAGAAGCCCAC
CTGGAGATCAGGGAGGATGGGACGGTGGGGGGCGCTGCTGACCAGAGCCCCGAAA
gtgagtgtgggccagagcctgggtctgagggaggaggggctgtgggtctggattcctggg
tctgagggaggaggggctgggggccttggcccctgggtctgagggaggaggggctgggga
tctggactcctgggtctgagggaggaggggctggggatctgggcccctgggtctgaggga

Exon  2 +       1890       1993   1   Internal    104    76        Good
cttgggtctgagttgggagggggctttggcttgggcttctcctgggtctgagggaggagg
taggctgtgggcttggactcccagggctgggacagagccggatggtgggacagagtcggg
tggtgggacagtcccgggtgggagaggtcctcgaaccaccttatcgctttcaccccttag
GTCTCCTGCAGCTGAAAGCCTTGAAGCCGGGAGTTATTCAAATCTTGGGAGTCAAGACAT
CCAGGTTCCTGTGCCAGCGGCCAGATGGGGCCCTGTATGGATCG
gtgagtttccaggaccctcctcaccacccaccatgctcctcctatatgtcgccctcacag
cctggggtgccttgtcttgctcatcccccccggagccagacttgattctatttgctctgc
acgcccccagctgcaacatttggaggttgaagttgtcatcagtgtttgcaagatgaggaa

Exon  3 +       2894       3184   0   Terminal    291    77        Good
gggcctggactcctgggtcggatggaggagaaactagggtctggacccctgggtctgagg
gaggaggcgctgggggcctggacccctgggtctgagggaggcagggctggggcctggatc
ctgggtcttacatcaggaaaacagaggaaccctgtctctgatcctgtttttgtcccctag
CTCCACTTTGACCCTGAGGCCTGCAGCTTCCGGGAGCTGCTTCTTGAGGACGGATACAAT
GTTTACCAGTCCGAAGCCCACGGCCTCCCGCTGCACCTGCCAGGGAACAAGTCCCCACAC
CGGGACCCTGCACCCCGAGGACCAGCTCGCTTCCTGCCACTACCAGGCCTGCCCCCCGCA
CTCCCGGAGCCACCCGGAATCCTGGCCCCCCAGCCCCCCGATGTGGGCTCCTCGGACCCT
CTGAGCATGGTGGGACCTTCCCAGGGCCGAAGCCCCAGCTACGCTTCCTGA
agccagaggctgtttactatgacatctcctctttatttattaggttatttatcttattta
tttttttatttttcttacttgagataataaagagttccagaggaggataagaatgagcat
gtgtgagtgtctgagggaagacatggcagctgttttgtctcccttggcccggacaatccc

--------------------------------------------------------------------------------