--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (16176 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        537        617   2   Internal     81    81        Good
atcggtccacctactatgctcccggcacccttagggctgaggtgtagggacttactccat
ccccagggaacagcgtgggtccggagaggcgactcccaggagggccccagggaggtcgca
gcccgagcagctttggactttggccagcgcccctctgaaactctgccccggcccccgcag
GGAGACTGGAGTTGGCCGAGCCCGATTTGGGACGCGTGCGTCGGGGTTGGTGAGGCTGCG
GATAGCGCTGGAACCGGGCAG
gtgagaggcccgggacccagggccgggccgggtggagcgcgtgggggcgcgggaggcagg
gtgcgcccccgcccctcggagaccccaggccgggccacgcggatgccggcggggggcgcg
cagaatcggggtcgctgggggcaggccccgggggacgagcctgagacggggtgggccggg

Exon  2 +       1201       1340   0    Initial    140    64    Marginal
tctcggcgcccgaggtcgcgcgcgcggaggcgggggcggcccgggatctccaagcgccgc
cgcgccctcctcccgcccgccctccgcccgcccgctcggcggcggcggcggcggcggagg
aggcggagaaggctggcaggcggcggccgggagagcgagcgcggcggccggaccggggcc
ATGGCGCCCGCGCAGCGCCCGCTGCTCCCGCTGCTGCTCCTGCTGTTACCGCTGCCGCCG
CCGCCCTTCGCGCGCGCCGAGGACGCCGCCCGCGCCAACTCGGACCGCTACGCCGTCTAC
TGGAACCGCAGCAACCCCAG
gtgagcgcggccgcgcgcggggggcgcccggggaccccccaacgccccccaagccgcgcc
cggcctcgcgcccccggagctccgggcgccccccacgcgcgcgccgccgccgggatgcgg
gcgcccggttcccgcgggagccccccagggagctccggccccccggagtttgggggactc

Exon  3 +       8702       8753   2   Internal     52    91   Excellent
gaggggaaagggagcctctgagaggaggccggacctcgagacccaagggttcaaatccag
acgcaagcccagaactgcaagattccgaagccccggaagggcccctgccctccaggcctg
gtgcccgggggagatttccctgcaacacgccctcccatgtcccctgtgctgggctcacag
GGGTGATGAAGGAGGCCTGGGAAGCTCTCTGTCCCTGGACGAATCCAACCAG
gtagggaagggctggagggtgacttcaccgcctccgccgccctgccttgaaattctttgc
tctggagatcttcatgccggatccctagtggggaaactgaggcgcaagtgagcacacctg
tctgccccttctcacccctggagacccaggaacccccggccccgcctggcgtggcatctc

Exon  4 +      10040      10202   2   Terminal    163    51    Marginal
ggtccttctcaacaggtgggagtgcagaatgaaagcagggctgggggctgcctggaggag
gcggcacagatgttaagcatgttaggtagatgcgaagtttctggagagggaattcttgtg
gagggacagctcgtgcagaggcccggagtcaggaaccccccgccggccctttgcacacag
GGGTCCAGATGTCACCCACCTGGACACCCACCTCGCTGCTGGCCCTGCCGTGGGGCTGTT
GGGGACACTGAGGCAGGAGGTGGGGGGCAGTGCCAGGCAAGAGATCGTGGGCTCCCAACC
TTGGAAGCCCGCCGTGATTGGGGTGTGCAACCCCACCTGCTGA
ccgctatcaccattcagggcccaggcggagtccaccttgtgaactgacccctcccccatt
ccccggcctgacttccccgtgcacctgtcccctgacccgtccctccccgctcaccctgtc
ccgtgccctgtgcacctgtccccggagccatctctccccgcgcacactgacccgtgcccc

Exon  5 +      10577      10890   2   Internal    314    96   Excellent
tgaccctgtcccccctggcgcaccctgacccgtcccccgtgctcctgaccccggccctcg
ccgcgcaccccgacccgtccctcgtgctcctgtcccctgaccctggccctccccgcgcac
cccgacccgtgccccgttcctcgctccgggcgctgacctctggccgccttgtccccgcag
GTTCCACGCAGGCGCGGGGGACGACGGCGGGGGCTACACGGTGGAGGTGAGCATCAATGA
CTACCTGGACATCTACTGCCCGCACTATGGGGCGCCGCTGCCGCCGGCCGAGCGCATGGA
GCACTACGTGCTGTACATGGTCAACGGCGAGGGCCACGCCTCCTGCGACCACCGCCAGCG
CGGCTTCAAGCGCTGGGAGTGCAACCGGCCCGCGGCGCCCGGGGGGCCGCTCAAGTTCTC
GGAGAAGTTCCAGCTCTTCACGCCCTTCTCCCTGGGCTTCGAGTTCCGGCCCGGCCACGA
GTATTACTACATCT
gtgagtggggtcgggccggggctgccggggcccgagtgggcggggacgcgggggcggggc
caggaagtgggcgggaccactggggtggggccggggagtgggcggggcagcgcagtgggc
ggggccgcggtgtggggccaggggggagtgggcggggccgcggaatggggccagggggga

Exon  6 +      13583      13648   1   Internal     66   100   Excellent
agactgctgggaaacagggggcattgtgtctggggctttgatgtacgattaggagtttta
agggtggctctccacctggggtcagggttgattcaccaaggtggggaagggagtacagcc
ccaggaggtctcaggcaccaagaggcacttccccactcatccccatcccctctcttctag
CTGCCACGCCTCCCAATGCTGTGGACCGGCCCTGCCTGCGACTGAAGGTGTACGTGCGGC
CGACCA
gtaagtgctcagggggatgggcaggatccaggcccccacccctgtgtcctaaacccacag
aaccagtgagtgttcagaagagccaggacagggggcctcgggtttccctatcttgccctg
ccttgccccagcctcgatttccccgtctgatgaacatgtcagaccttcgagagtgaaggt

--------------------------------------------------------------------------------