--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (8657 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1294       1379   0    Initial     86    88        Good
cctctccaaaacgcagcatcgcgtctcgggggaggagtctgtaccctcgtgatgtccccg
ccccggttcccaggcaagtttagggaagtgaaaggcgccaggtgccagtcctggcctctg
atgtaacccagcgccccgcagtcccgacacagattcctggatctcagccccatagcagct
ATGATCCCGCTGCTGCTGGCAGCGCTGCTGTGCGTCCCCGCCGGGGCCCTGACCTGCTAC
GGGGACTCCGGGCAGCCTGTAGACTG
gtgagtgcgcagcggggggcctaccatcgccccggggtccggctgcggtcactcaaccgg
gatggctacctcctcggggaaccctggggtgccttctcttccctctctcctatttctgtg
cattctccgacctccaggttcgtggtctacaagctgccagctcttagagggtccggggag

Exon  2 +       1517       1697   2   Internal    181   100   Excellent
gggccctgacctgctacggggactccgggcagcctgtagactggtgagtgcgcagcgggg
ggcctaccatcgccccggggtccggctgcggtcactcaaccgggatggctacctcctcgg
ggaaccctggggtgccttctcttccctctctcctatttctgtgcattctccgacctccag
GTTCGTGGTCTACAAGCTGCCAGCTCTTAGAGGGTCCGGGGAGGCGGCGCAGAGAGGGCT
GCAGTACAAGTATCTGGACGAGAGCTCCGGAGGCTGGCGGGACGGCAGGGCACTCATCAA
CAGCCCGGAGGGGGCCGTGGGCCGAAGCCTGCAGCCGCTGTACCGGAGCAACACCAGCCA
G
gtgaagggggccccgggccaactaggggcgaaactctagggctgccctgcctgggaggaa
tttcacgttgcctccgtttatccgcccgcagctcgccttcctgctctacaatgaccaacc
gcctcaacccagcaaggctcaggactcttccatgcgtgggcacacgaagggtgaggcctg

Exon  3 +       1789       1867   0   Internal     79    83        Good
gctggcgggacggcagggcactcatcaacagcccggagggggccgtgggccgaagcctgc
agccgctgtaccggagcaacaccagccaggtgaagggggccccgggccaactaggggcga
aactctagggctgccctgcctgggaggaatttcacgttgcctccgtttatccgcccgcag
CTCGCCTTCCTGCTCTACAATGACCAACCGCCTCAACCCAGCAAGGCTCAGGACTCTTCC
ATGCGTGGGCACACGAAGG
gtgaggcctggattgggggctggggagagactcgggtcccatttttccaaggtaacccct
gacgtgcatggggtggtcggggagatctgcactgtcagaccctgggcatctattcccccc
aacttttttttttctttgtttttgagacggtgggagttcgctctgtcacccaagctggag

Exon  4 +       3787       4287   1   Internal    501    60    Marginal
caagcgattctcctgcctcagcctcctgagtagctgggattacaggcgtccaccaccacg
ctcagctaatttttgtatttttagtagagatggggtttcgccatgttggccaggctgatt
tctaactcctgacctcaggtgatctgtgtgtctcggtctcccaaagtgctgggattacag
GCGTGAGCCACTGCGCCCGACCTCCCCTAATGCCTTCTTTTGGTCCAGGTGTCCTGCTCC
TTGACCACGATGGGGGCTTCTGGCTGGTCCACAGTGTACCTAACTTCCCTCCACCGGCCT
CCTCTGCTGCATACAGCTGGCCTCATAGCGCCTGTACCTACGGGCAGACCCTGCTCTGTG
TGTCTTTTCCCTTCGCTCAGTTCTCGAAGATGGGTAAGTCGAGTCAGGGACACAGGATGA
GTCCTGGGTTTACTGACCAGAACCTGGAACGATCTTGCATTTCCTCCTCCCCTTGTCCTC
CAGGCAAGCAGCTGACCTACACCTACCCCTGGGTCTATAACTACCAGCTGGAAGGGATCT
TTGCCCAGGAATTCCCCGACTTGGAGAATGTGGTCAAGGGCCACCACGTTAGCCAAGAAC
CCTGGAACAGCAGCATCACACTCACATCCCAGGCCGGGGCTGTTTTCCAGAGCTTTGCCA
AGTTCAGCAAATTTGGAGATG
gtgagtctcaaggttgagggttggagagctccttctctgcagacagggtgactggtgtgg
ccatggctgagttcaagtcagcggtagagaccaggtctgtttgggagctataatcacatg
atcagtgaacagacctgggttcaaaccctgggttttgctgtgtgatgtataacttcacct

Exon  5 +       4090       4287   1   Internal    198   100   Excellent
ctgctgcatacagctggcctcatagcgcctgtacctacgggcagaccctgctctgtgtgt
cttttcccttcgctcagttctcgaagatgggtaagtcgagtcagggacacaggatgagtc
ctgggtttactgaccagaacctggaacgatcttgcatttcctcctccccttgtcctccag
GCAAGCAGCTGACCTACACCTACCCCTGGGTCTATAACTACCAGCTGGAAGGGATCTTTG
CCCAGGAATTCCCCGACTTGGAGAATGTGGTCAAGGGCCACCACGTTAGCCAAGAACCCT
GGAACAGCAGCATCACACTCACATCCCAGGCCGGGGCTGTTTTCCAGAGCTTTGCCAAGT
TCAGCAAATTTGGAGATG
gtgagtctcaaggttgagggttggagagctccttctctgcagacagggtgactggtgtgg
ccatggctgagttcaagtcagcggtagagaccaggtctgtttgggagctataatcacatg
atcagtgaacagacctgggttcaaaccctgggttttgctgtgtgatgtataacttcacct

Exon  6 +       6306       6679   1   Terminal    374    73        Good
aggttgcaatgagcctagattgcaccaatgcactctagcctgggcgacagagcaagactc
catgtcaaaaaaaaaaaaaaaaaaggaaatatggaaactgagctgagagaggggaagtgg
actagggactccctcgcagtggccctgaccctacctgtgccctctctccatcctttgcag
ACCTGTACTCCGGCTGGTTGGCAGCAGCCCTTGGTACCAACCTGCAGGTCCAGTTCTGGC
ACAAAACTGTAGGCATCCTGCCCTCTAACTGCTCGGATATCTGGCAGGTTCTGAATGTGA
ACCAGATAGCTTTCCCTGGACCAGCCGGCCCAAGCTTCAACAGCACAGAGGACCACTCCA
AATGGTGCGTGTCCCCAAAAGGGCCCTGGACCTGCGTGGGTGACATGAATCGGAACCAGG
GAGAGGAGCAACGGGGTGGGGGCACACTGTGTGCCCAGCTGCCAGCCCTCTGGAAAGCCT
TCCAGCCGCTGGTGAAGAACTACCAGCCCTGTAATGGCATGGCCAGGAAGCCCAGCAGAG
CTTATAAGATCTAA
cccttatggccaggtgcagtggctcacgtatgtaatcccagcactttgggaagccaagga
gggaggatcacttgaactcaggaattcgagaccagcctgggctacatagtgagaccacat
ctctactagaacttaaaaaaagttagccaggcacggtgataaatgcctgtagtcccagcc

Exon  7 +       7979       8118   2   Internal    140    55    Marginal
ctatggtcccgggggtgcgggactggacactccttttttggtcaggcctgctgggggcac
agcttcagcagggcaccgggaggtcagccccacttgaggcttggtgcctgagcccaagag
ggatgcgggtgggactggggtcactgcactgctgggtgcactgcacttcgctggggctag
GGAGGGTGTCTGGGGCTCCGGGGAGAGCTTTGGGGAGGCGGGCTTGGAGCGAGGACCGCT
CAGCGTGGTGCGCTCCTCCACCACCTCCAACACCCAGCGCTCCCGGCCCCGGGGGGCCTC
GGGCACGGAAGGCGCCAGGG
gtgcgggttcctgcaaccccttggagtccgcgcccagaggctgaggcaccacagccttag
ccccgggccgcgcaggctctacgacaatgggtaccaggggtgtgcccgcctcgccagagc
tgctgcgccggcctgtctcgtgttcctgcaccgggctcagcgccgccttggccacagccc

--------------------------------------------------------------------------------