--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (21461 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        487        561   0    Initial     75    54    Marginal
aaggccccgcggtaaggggacacgcatacaccacagcctagactccctgacagaccctct
ctagttgttgcaagttagggagcgggtatctgggcgaccctggagggcagagattggaag
gggttacggaggggccgttttggctctgggtggagacatctgactgtgatgggggtcgtg
ATGGACGCCATCGAGATGTACACAGTCGGAATGGAGGGTTCTGTTGCCGCTTGGAAGGAG
GTATCCGTCCTGAAC
gtgagatgagggaattctggttttgatcaggggaaggaacttatagactgcgggggtggt
ggtgggggggcgggatttccatttgggatcacgagagagcacagttgagatgtagatccc
tggttgtcactagaagtgagggacaatctaatggaggagtgcccaggaccagatcatata

Exon  2 +       1817       2202   1   Internal    386    77        Good
cctgttcttaggggacctcgggcgggaccattccctcccgggggagggggaggccgaggc
ggttgggggtgcgggagcggccctgcccggcgcgattgggcgggggagacgcgctggcgg
tgtggggttcgggcctccgcgtcgctgaccactgccccctccccgctgtgtgggttctag
GCCGGGTTCTGAGCTTGTTCCGCCTCCCTCCCCCGGGAATGGCGCTATCCGGGTCGACCC
CGGCCCCGTGCTGGGAGGAGGATGAGTGCCTGGACTACTACGGGATGCTGTCGCTTCACC
GTATGTTCGAGGTGGTGGGCGGGCAACTGACCGAGTGCGAGCTGGAGCTCCTGGCCTTTC
TGCTGGATGAGGCTCCTGGCGCCGCCGGAGGCTTAGCCCGGGCCCGCAGCGGCCTAGAGC
TCCTGCTGGAGCTGGAGCGCCGCGGGCAGTGCGACGAGAGCAACCTGCGGCTGCTGGGGC
AACTCCTGCGCGTGCTGGCCCGCCACGACCTGCTGCCGCACCTGGCGCGCAAGCGGCGCC
GGCCAGGTACGGTTGAATGGGAGGGT
gtcacacttcctgggaggaaagggcctggctcccgctgggcctccctggtgccctgatac
ggacagtgccatatcaggcagcttatgtcccattctgctactctctcttcccacaatatc
aatgagcaacataagaggaagaaagcatggctttgggaatttggccacatcagtgatgat

Exon  3 +       3610       3729   0   Internal    120    88        Good
gataagttctctctcttaggaggcatctgagcaacctctgcaggaggtgtttgagaatga
gtgggtatttgggctctgactactggggaacttaggcacctcgtggtgcaggcattcttc
caggggtgggaattagggccaggaggctgaatgcttcttcctgttcttctcttcctccag
TGTCTCCAGAACGCTATAGCTATGGCACCTCCAGCTCTTCAAAGAGGACAGAGGGTAGCT
GCCGTCGCCGTCGGCAGTCAAGCAGTTCTGCAAATTCTCAGCAGGGTCAGTGGGAGACAG

gtgagcccagctgggtgggtgtaatggcagcatccctcttttccttatgaattgtgccca
tcaaggaaggggcctgaggggttattctgtctcattttcactgtgtgtgtgtgtgtgtgt
gtgtgtgtgtgtttattgctacagatactctgttctgaagcaacatacagaattgttgca

Exon  4 +       9022       9156   0   Terminal    135    52    Marginal
ccttctagatgatgctagatggtactcttcatcttttagacagggccactgaagaaggga
ggcagactggctcactcagggtctcagcaccgagaacaccttgagttcttttccaggcat
acacctgggcactctagctgtcatcctggtcctcaacttgccccatttttttcccctcag
GCTCCCCCCCAACCAAGCGGCAGCGGCGGAGTCGGGGCCGGCCCAGTGGTGGTGCCAGAC
GGCGGCGGAGAGGGGCCCCAGCCGCACCCCAGCAGCAGTCAGAGCCCGCCAGACCTTCCT
CTGAAGGCAAAGTGA
cctgtggtaggtgtctgtaggctttggcaatgcatgtagagtgccccgggtgggttcaga
gggtgggagaaatgagcatttttctgggggatgtgacacacttggcagatgggtgtcagc
tctcgttcaccacagtggaattcttgtcctttctctcgccatcttgcctgtctacatcct

Exon  5 +      14303      14400   1   Internal     98    64    Marginal
tgaagcaccttggctgcctctctccagcaaggccggaagcatctcccagtgttgtgggag
cacaggtcctcttcttccccagcccatctttgttagttcatttttgtgttgctataaaga
aatacctgagactgtgtaatttgtaaagaaaagagatttacttggctcacggttctgcag
GCTGTACAAGAAGCAGGGTGCCAGCATCTGCTTCTGTTGAGGACCTCCGGAAGCTTCCAT
TCATGGTGGAAGGCCAAGGGGAGCAGGCTTGTCACATG
gtgagagttggggggtgggggagctgccacactcttaaccagctctcacgggaaatacca
gagcaagaactcactcatcaccaagggattcatgagggacccagccccatgatccaacac
cttccatgaggttccacctacaatgttggagtcacatttccacatgagatttggagagaa

Exon  6 +      19033      19424   1   Terminal    392    95   Excellent
ggagaagaggaggacgtacttggtcagggaaccccacagagccggggaggctgtgtcagg
actagggtgtggctaccggaagggggtggagggagaaggctggagggaggaagggtggcg
ttccccataagtgtgtctagtgttggccccctccctgacaaatccctccttcccctgcag
ACATCCGGCTCCGGGTTCGAGCAGAGTACTGCGAGCATGGGCCAGCCTTGGAGCAGGGCG
TGGCATCCCGGCGGCCCCAGGCGCTGGCGCGGCAGCTGGACGTGTTTGGGCAGGCCACCG
CAGTGCTGCGCTCAAGGGACCTGGGCTCTGTGGTTTGTGACATCAAGTTCTCAGAGCTCT
CCTATCTGGACGCCTTCTGGGGCGACTACCTGAGTGGCGCCCTGCTGCAGGCCCTGCGGG
GCGTGTTCCTGACTGAGGCCCTGCGAGAGGCTGTGGGCCGGGAGGCTGTTCGCCTGCTGG
TCAGTGTGGATGAGGCTGACTATGAGGCTGGCCGGCGCCGCCTGTTGCTGATGGAGGAGG
AAGGGGGGCGGCGCCCGACAGAGGCCTCCTGA
tccaggactggcaggattgatcccacctccaagtctccgggccaccttctcctgggagga
cgaccatctctacccctagaggactgtcactctagcatctttgaggactgcgacaggacc
gggacagcaggccccttgacagcccctcccacaggatgtgggctctgaggcctaaaccat

--------------------------------------------------------------------------------