--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (7466 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1264       1332   0    Initial     69    64    Marginal
ccttacatgaagcgggagtgggtggagccccacccctggaacttcctcttttggggttct
tcctttctctctcagctctccgtctctctttctctctcagcctctttctttctccctgtc
tcccccactgtcagcacctcttctgtgtggtgagtggaccgcttaccccactaggtgaag
ATGTCAGCCCAGGAGAGCTGCCTCAGCCTCATCAAGTACTTCCTCTTCGTTTTCAACCTC
TTCTTCTTC
gtgagttgcctcatggctacccagccggggcccagcccctgccgctaacccagccctcat
cttcccctgtggcccacccccgtatccgcatctcctctccccaggtcctcggcagcctga
tcttctgcttcggcatctggatcctcattgacaagaccagcttcgtgtcctttgtgggtg

Exon  2 +       1386       1509   0   Internal    124    93   Excellent
ccccactgtcagcacctcttctgtgtggtgagtggaccgcttaccccactaggtgaagat
gtcagcccaggagagctgcctcagcctcatcaagtacttcctcttcgttttcaacctctt
cttcttcgtgagttgcctcatggctacccagccggggcccagcccctgccgctaacccag
CCCTCATCTTCCCCTGTGGCCCACCCCCGTATCCGCATCTCCTCTCCCCAGGTCCTCGGC
AGCCTGATCTTCTGCTTCGGCATCTGGATCCTCATTGACAAGACCAGCTTCGTGTCCTTT
GTGG
gtgaggggggctggggcaggtgggagggcctcccccaacccaagcaacttcctggggtct
cccttgtctcagggagacctacggtgccctactctgcaggcaggctacaggctcccatcc
actgctcaccggaggcttcttggagcctgagtcttcttccggcaaatggggttgtgcata

Exon  3 +       2632       2756   1   Internal    125   100   Excellent
aggcccagaaagaagagaaagtttcagaaggaaacagggactcagggtggggcagggaca
gagtcccagagagaggggcaccaagatactgctccccacttgggtggctgcctaggtggg
aaatggggctgcctggagctgtgccacacagctcatcatcactcccctcacctctcccag
GCTTGGCCTTCGTGCCTCTGCAGATCTGGTCCAAAGTCCTGGCCATCTCAGGAATCTTCA
CCATGGGCATCGCCCTCCTGGGTTGTGTGGGGGCCCTCAAGGAGCTCCGCTGCCTCCTGG
GCCTG
gtgagtgcaccatccctctccgtccctaggaacactcctatccccaccctcaaaaatggc
ctgggccggggttgcaggggtggtcagcctgatctctccactctgctccccagtattttg
ggatgctgctgctcctgtttgccacacagatcaccctgggaatcctcatctccactcagc

Exon  4 +       2870       2944   0   Internal     75   100   Excellent
caccatgggcatcgccctcctgggttgtgtgggggccctcaaggagctccgctgcctcct
gggcctggtgagtgcaccatccctctccgtccctaggaacactcctatccccaccctcaa
aaatggcctgggccggggttgcaggggtggtcagcctgatctctccactctgctccccag
TATTTTGGGATGCTGCTGCTCCTGTTTGCCACACAGATCACCCTGGGAATCCTCATCTCC
ACTCAGCGGGCCCAG
gtgagcttcctgcagtggccaccacccacccccagcagggaggagagggaagggagtggt
gggagagggtggagagagaccgaaacaagggcagacaggggctaacctagataaagagaa
ataagaggctgggcctggtggctcacgcctgtaatcccataatcccagcactttgggagg

Exon  5 +       3349       3477   0   Terminal    129    47    Marginal
gtgagaccccatctatatttaaaaaaaaaatccgggtgtgatggtgtgcacctggggtcc
cagctacttgggaggtcgaggtgggaggatcacttgagccagggagtttgaggctacagt
gagccatgcactcagcctgggtgacagagtgagaccctgtctcaaaaaataaattaatag
AAAGACACACCGACCTGGACCAAGGGAGACAGGCATAAACAGCTCCAAAGGGAAACACAC
GGGAAAAAGAGAGAACAAGAGAAAGAAATAGACGCCCTGAAAGAAGAGACAGAGACTTAT
GAGCCGTAG
aaatagtggaagaaacagaaagacagacctgaagtacacagagctagccattcagtaagg
atttgagactggcccagagatgcacagggcccgcctgaggctggcacagcctgagagggg
gaggggtggggcggggaagataaggcccagcctcactggtggcctctcagctggagcgaa

Exon  6 +       3648       3752   0   Internal    105   100   Excellent
tgagccgtagaaatagtggaagaaacagaaagacagacctgaagtacacagagctagcca
ttcagtaaggatttgagactggcccagagatgcacagggcccgcctgaggctggcacagc
ctgagagggggaggggtggggcggggaagataaggcccagcctcactggtggcctctcag
CTGGAGCGAAGCTTGCGGGACGTCGTAGAGAAAACCATCCAAAAGTACGGCACCAACCCC
GAGGAGACCGCGGCCGAGGAGAGCTGGGACTATGTGCAGTTCCAG
gtaagcccccctcctccagttccctcccggactgacccgcctcagccctgtgcttggagg
agactccaccccaacgtgggcccgacccccagctctacgatcctaacacaccccaatccc
tcccaggcccgacgctccccactccccagatgacacaactgtccccggcgtcgcctggtc

Exon  7 +       4423       4560   0   Internal    138    93   Excellent
tgttcccgtaatgtcccctggctccggccccatcgtgaccccagcccactgtcccccact
ccacacccaccacttagtcccctgctccccgacctgacctcatacccatcaccttgtccc
ctgatccccaacatcatatgtctccagtcccggtccctctgactcgtatccctctcccag
CTGCGCTGCTGCGGCTGGCACTACCCGCAGGACTGGTTCCAAGTCCTCATCCTGAGAGGT
AACGGGTCGGAGGCGCACCGCGTGCCCTGCTCCTGCTACAACTTGTCGGCGACCAACGAC
TCCACAATCCTAGATAAG
gtgatcttgccccagctcagcaggcttggacacctggcgcggtccagacacagtgcagac
atctgcgctgtccctgcagagagccacatctaccgcgaggtgggcaggggttcggagcat
aaacctgtcgaatggggcggggcctgcgggagggggagggctgtcagtgagtagcggcct

Exon  8 +       5053       5136   0   Internal     84    52    Marginal
ggaggggccaggcttggaaaaggtgaagcgagggtgcactagtaaggagactagagtgcc
ctggtgactaggggagcgggtagatgcctgaagacggtgagggttggcctgaaaagaacg
ctgggcctgggcttgagagtcccagaaagaatccctttaacttttccctacaccccccag
GGCTGCGCGCAGGGCCTCCAGAAGTGGCTGCACAACAACCTTATTTCCATAGTGGGCATT
TGCCTGGGCGTCGGCCTACTCGAG
gtgatctggccccgcccccacccgcgatcggccctaaatccctagatggccctgcccttc
atttcgcgtccttcggttgcctgggaaggacgagctcagggcggagcgcagcccaccccg
gccctcccgccgctccacccagcaccggagggtgggggcggcccagcttcagggagccct

Exon  9 +       5381       5520   0   Internal    140    79        Good
cgcgtccttcggttgcctgggaaggacgagctcagggcggagcgcagcccaccccggccc
tcccgccgctccacccagcaccggagggtgggggcggcccagcttcagggagccctgatt
gggtgtacgcagggaaagcctcctgctattggctgcgatctccctcccctttctccgcag
ATGACTGTCATGGTGCTGAGCGTACAGCTACAGCGCAGGGCACTCCGCCGGAAATGCGAG
CCGCACGTGCCGGGCGCTGGGGATTCGAGCCCCGGGCCCAGCCTGATCGCTGACGGCGGC
GGCGGGCACAGCGGCAGTCT
gtggggtggctggggcatggcgggtgcctgccccaactggggagacaaggcaccgcaggg
caagctgcccatggccctggggctctggccgctgtgggttcaagacgaggaccagcctga
cactggaagtgcgggcgcagaattagaggaggcacaattagaggctgaggcagaggggga

Exon 10 +       6009       6051   2   Terminal     43    94   Excellent
cccgcccttttctacctatccccttctccagccccttcccgcccaattcacggccccacc
cctgacctttctcgcccgggtgggcatcacccccgtctcgccagcaccccttcgacttct
ctgacctcatctcctttctctatagctcgggttcatgacgctctcgatattcctgtgcag
AAACCTGGACCACGTCTACAACCGGCTCGCTCGATACCGTTAG
gccccgccctccccaaagtcccgccccgcccccgtcacgtgcgctgggcacttccctgct
gcctgtaaatatttgtttaatccccagttcgcctggagccctccgccttcacattcccct
ggggacccacgtggctgcgtgcccctgctgctgtcacctctcccacgggacctggggctt

--------------------------------------------------------------------------------