--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (20550 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       2557       2652   0    Initial     96    51    Marginal
tcaagtgtatgtgaccttgaagatgttttttgcatgtgacatgatgagtacctgcggggc
tgatgtcagctctgcctggggaatctgcctcagcttcagaccctgcaccccaaattcatg
cttagcccaggccagacccccttcctgctgtcggcaagcagcttagctttccgcacaccc
ATGAACAGATACCCAGCAGCCTTTGGCATGAGCCATGTGGCCCGAGGAGATAAACAGACA
GAGAGAGGAACATTGATGCGTGTGAAATGTTGGCAG
gtgagtgggaggggcttgggttggtgctgagaccggagacacactctgctgtcacatcct
tcagggtccccgggggccagcacggagggccatgatcatgtaaattgggacttaaattta
actctatgtaaatataactctatgcagaggtcagggatggtagaggacaagctcactgca

Exon  2 +       4545       4916   1   Internal    372    83        Good
aggctgaggtgggaggatcacttgaggtcaggagttcaaggccagcttggacaacatagc
aagacccctatctctaaaaagaataaaaaattaaacaaattttaaaataaaaaataactt
ttaaaagaaggctctcatgcccccttagtaatgctttctgatcactgtggtgagttctag
AATACTTGGCTTTCTCTGACTCAAGTAAATGGGTTTTTGAGCACCCTGAAACCCTCTACG
CCTGGGAGGGGGCCTGCGTCTGGATCCCCTGCACCTACAGAGCCCTAGATGGTGACCTGG
AAAGCTTCATCCTGTTCCACAATCCTGAGTATAACAAGAACACCTCGAAGTTTGATGGGA
CAAGACTCTATGAAAGCACAAAGGATGGGAAGGTTCCTTCTGAGCAGAAAAGGGTGCAAT
TCCTGGGAGACAAGAATAAGAACTGCACACTGAGTATCCACCCGGTGCACCTCAATGACA
GTGGTCAGCTGGGGCTGAGGATGGAGTCCAAGACTGAGAAATGGATGGAACGAATACACC
TCAATGTCTCTG
gtaaggccttcggggagcgggtcctctgctctgggcaggggtgagtgggaggcaggaaat
acctgactcctggcacagagctcacaaaccgagcttcctgcagagctcaggcaggggacg
ccagcggatgacgatggcgatgcagcagcactagacagagctgcgggacctcggatgtcc

Exon  3 +       8171       8333   0   Internal    163    77        Good
tcccccaggctcctgcacgggctctgttcttttgcagaaaggccttttccacctcatatc
cagctccctccagaaattcaagagtcccaggaagtcactctgacctgcttgctgaatttc
tcctgctatgggtatccgatccaattgcagtggctcctagagggggttccaatgaggcag
GCTGCTGTCACCTCGACCTCCTTGACCATCAAGTCTGTCTTCACCCGGAGCGAGCTCAAG
TTCTCCCCACAGTGGAGTCACCATGGGAAGATTGTGACCTGCCAGCTTCAGGATGCAGAT
GGGAAGTTCCTCTCCAATGACACGGTGCAGCTGAACGTGAAGC
gtgagtctccccggcatgcctgtgggaagggcaaggtctgtgtcaccttctccccagccc
cgcagggggcatgcacccagggcagggggaagcctgcacagacggcggcatcctccagcc
ctggtcacgccgccttgtcagccctggtgtttcgggaaaaagatttgctctagcctaaca

Exon  4 +       9747      10013   1   Internal    267    85        Good
ggagaccaagaagtagaggaagtgggagggggaagctgagagccgagttaggaggctgtg
accatcacctgggtgaagggactggcaggccatggctttgtcagaataaaagcactttcc
acaccctccaccctctgaggattccccgccccctccccgactgcccctctgctcctccag
ACACCCCGAAGTTGGAGATCAAGGTCACTCCCAGTGATGCCATAGTGAGGGAGGGGGACT
CTGTGACCATGACCTGCGAGGTCAGCAGCAGCAACCCGGAGTACACGACGGTATCCTGGC
TCAAGGATGGGACCTCGCTGAAGAAGCAGAATACATTCACGCTAAACCTGCGCGAAGTGA
CCAAGGACCAGAGTGGGAAGTACTGCTGTCAGGTCTCCAATGACGTGGGCCCGGGAAGGT
CGGAAGAAGTGTTCCTGCAAGTGCAGT
gtgagcccctcggagctggggacaggccaggcagggaggtagcaggggtggacccggaga
ggggagccacgggggctctcggggccgtgtgcacaggttgggggtgctctcctcacccct
ccactcgcctctgccccctcttccagatgccccggaaccttccacggttcagatcctcca

Exon  5 +      12873      13130   1   Internal    258    84        Good
gagagccagggcagggtttctgttctcacacagatgcaggaaggacgcacaagcccccct
ttgattaatttaggacctgtgcagatgcccgggacaggtagcgggagaagaggaagcagg
agggaaggggtactgtggacagctggcttttctttactcacctctctggttttcttccag
ATCCTCCCAAGAAGGTGACCACAGTGATTCAAAACCCCATGCCGATTCGAGAAGGAGACA
CAGTGACCCTTTCCTGTAACTACAATTCCAGTAACCCCAGTGTTACCCGGTATGAATGGA
AACCCCATGGCGCCTGGGAGGAGCCATCGCTTGGGGTGCTGAAGATCCAAAACGTTGGCT
GGGACAACACAACCATCGCCTGCGCAGCTTGTAATAGTTGGTGCTCGTGGGCCTCCCCTG
TCGCCCTGAATGTCCAGT
gtgagtccctgggctaggcagggggatctgggaggtggcccggctgggatgaggggatga
aggcaacgaggccggagcctgggccagtgtcttcaacagaattgagggacaggagcctgg
cgtcagggccaaggggaggggaggcctggggacagcaaaagggacagggagcggagaggt

Exon  6 +      13335      13598   1   Internal    264    76        Good
gatctgggaggtggcccggctgggatgaggggatgaaggcaacgaggccggagcctgggc
cagtgtcttcaacagaattgagggacaggagcctggcgtcagggccaaggggaggggagg
cctggggacagcaaaagggacagggagcggagaggtcagcttgggacccttgccctccag
ATGCCCCCCGAGACGTGAGGGTCCGGAAAATCAAGCCCCTTTCCGAGATTCACTCTGGAA
ACTCGGTCAGCCTCCAATGTGACTTCTCAAGCAGCCACCCCAAAGAAGTCCAGTTCTTCT
GGGAGAAAAATGGCAGGCTTCTGGGGAAAGAAAGCCAGCTGAATTTTGACTCCATCTCCC
CAGAAGATGCTGGGAGTTACAGCTGCTGGGTGAACAACTCCATAGGACAGACAGCGTCCA
AGGCCTGGACACTTGAAGTGCTGT
gtgagtgagggccggaggctgggagtggagcagagaagggaccagtggcctgcctggtag
tgacttcgcaccccctccccctgcccgccatgcagatgcacccaggaggctgcgtgtgtc
catgagcccgggggaccaagtgatggaggggaagagtgcaaccctgacctgtgagagcga

Exon  7 +      13694      13957   1   Internal    264    75        Good
ccagaagatgctgggagttacagctgctgggtgaacaactccataggacagacagcgtcc
aaggcctggacacttgaagtgctgtgtgagtgagggccggaggctgggagtggagcagag
aagggaccagtggcctgcctggtagtgacttcgcaccccctccccctgcccgccatgcag
ATGCACCCAGGAGGCTGCGTGTGTCCATGAGCCCGGGGGACCAAGTGATGGAGGGGAAGA
GTGCAACCCTGACCTGTGAGAGCGACGCCAACCCTCCCGTCTCCCACTACACCTGGTTTG
ACTGGAATAACCAAAGCCTCCCCTACCACAGCCAGAAGCTGAGATTGGAGCCGGTGAAGG
TCCAGCACTCGGGTGCCTACTGGTGCCAGGGGACCAACAGTGTGGGCAAGGGCCGTTCGC
CTCTCAGCACCCTCACCGTCTACT
gtaaggcctcttcctgctcttgttcttcttggtggtggtcagtccttccttccttccttc
cttccttccttccttccttccttccttcctttctttctctctttcttttcctcctcctct
tcttcccctcctcctcctcttcctccttcttcttcttcttctgctttctccctctcctcc

Exon  8 +      16821      16917   1   Internal     97   100   Excellent
ctaaagggaggcccagagcaagcaggggccgttgtcaccctcttcctctgcacccctgca
cgcatgcaggggagaaggacgagtctggctgcagagagaagtccaggatgccttccaggc
aaaggctgccagggagagctggcccctcagttgattaaggtctctcctttctccacccag
ATAGCCCGGAGACCATCGGCAGGCGAGTGGCTGTGGGACTCGGGTCCTGCCTCGCCATCC
TCATCCTGGCAATCTGTGGGCTCAAGCTCCAGCGACG
gtgagctcctgccatcccccaccacctcctctatcccttggcagaggcccgtgtccagtt
gctccatctcgaagcctccagcctgtggagtccctgaccctcacacatgtgcctttattt
ctcagttggaagaggacacagagccagcaggggcttcaggagaattccagcggccagagc

Exon  9 +      18143      18227   2   Internal     85    73        Good
gcctactccctccacgcacatttgcacgagctcctactgtgagctttgggcactggggag
gccacaggttttacataaggggctgaggttggggtgctgttgggggctctgggtgttgag
agggaggagagttcgtgggagatgcttcatgcgtggtcgtctatctgccctgtctctcag
AGATGCAGAGTCCTCAGAGATGCAGAGACCTCCCCCGGACTGCGATGACACGGTCACTTA
TTCAGCATTGCACAAGCGCCAAGTG
gtaaggagggtctccccaggtctccccagaggggctgtggaaggctggggacagggcctg
gcctcagtggtgggtcccacataggaaggagttgggtaggcatccgtggtggcagaggtt
gggtgttggagacggttgctccggcagagctggccagagccaggcaggtacctccaggtc

Exon 10 +      18558      18689   0   Terminal    132    61    Marginal
tggccagagccaggcaggtacctccaggtcctggatgccggccacagccagtttcctgac
acgaggacacccgcctgggcttttggacccccgggtggaatgaaggagagaatgcggaga
aaagcggcggtggaggctggcgacagtggggccaggctaaccaccatgcggttttctcag
GGCGACTATGAGAACGTCATTCCAGATTTTCCAGAAGATGAGGGGATTCATTACTCAGAG
CTGATCCAGTTTGGGGTCGGGGAGCGGCCTCAGGCACAAGAAAATGTGGACTATGTGATC
CTCAAACATTGA
cactggatgggctgcagcagaggcactgggggcagcgggggccagggaagtccccgagtt
tccccagacaccgccacatggcttcctcctgcgcgcatgtgcgcacacacacacacacac
gcacacacacacacacacactcactgcggagaaccttgtgcctggctcagagccagtctt

--------------------------------------------------------------------------------