--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (8280 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1272       1362   0    Initial     91    84        Good
ggccatgggcatagaccaatgacaaagtggcaggggcgggcccaagggctgggtcaggtt
ggtttgagaggcgggtgggtataaaagtgcaaggcgggcggcggcgtccgtccgtactgc
agagccgctgccggagggtcgttttaaagggcccgcgcgttgccgccccctcggcccgcc
ATGCTGCTATCCGTGCCGCTGCTGCTCGGCCTCCTCGGCCTGGCCGTCGCCGAGCCTGCC
GTCTACTTCAAGGAGCAGTTTCTGGACGGAG
gtaacgcctggtcccgcctcgaggccgccccgacgacgcggccggcccccgatcctggat
ctgcgttgtcgcccgtaattaccgtttagaggtccaacacggtggcctcccgggactaga
gccgcgggcgatttctcttctgcgtccctggggagcgcggagggcgtagcggcctcccgc

Exon  2 +       1726       1887   1   Internal    162    88        Good
gggagttagggttagcccgaggatctctgaaggcacccgacgtgtcaaactagaggttgg
aatggggagtgtcggggatctcctttcctgtccccagcagcttgtggctctcggcagatg
tttggtgtggggggggattagcacagccgctctgacctacccctctaatcccccacttag
ACGGGTGGACTTCCCGCTGGATCGAATCCAAACACAAGTCAGATTTTGGCAAATTCGTTC
TCAGTTCCGGCAAGTTCTACGGTGACGAGGAGAAAGATAAAGGTAAGAGCCTAGGAGTGG
GTGCTCAGATCCGGGAGGACTTCCTGGCAGAAGTCCTTGTCT
gtacacacacagccgggacagtccccttggaggaggacaggtggaggaagtgggggagtc
ttctctattctctaagtcgagggtcctcgcgagtcaaggcccaacggtgacctcactacc
gtcccgtctcaggtttgcagacaagccaggatgcacgcttttatgctctgtcggccagtt

Exon  3 +       2020       2223   1   Internal    204   100   Excellent
gagtgggtgctcagatccgggaggacttcctggcagaagtccttgtctgtacacacacag
ccgggacagtccccttggaggaggacaggtggaggaagtgggggagtcttctctattctc
taagtcgagggtcctcgcgagtcaaggcccaacggtgacctcactaccgtcccgtctcag
GTTTGCAGACAAGCCAGGATGCACGCTTTTATGCTCTGTCGGCCAGTTTCGAGCCTTTCA
GCAACAAAGGCCAGACGCTGGTGGTGCAGTTCACGGTGAAACATGAGCAGAACATCGACT
GTGGGGGCGGCTATGTGAAGCTGTTTCCTAATAGTTTGGACCAGACAGACATGCACGGAG
ACTCAGAATACAACATCATGTTTG
gtgagggcctgcttcctggtgctgatctctgtcccattagttagagggagacccagaccc
cattgactttcttaataatgattttttttggaaggggagctaaaagaataagtcccagca
acaatttattgcattatgatcgcagatctaggctgttaatttaatttgcgtgtttgtata

Exon  4 +       2645       2739   1   Internal     95   100   Excellent
tctcctttaaacttaaggctccacccacagcccattcaggacagaatcagggtctgagtt
tctcttctcagccttgacagacccgagttgaagaaccaggtcttccttttataaagaggg
gtgagagcctcgagatgatgggtagtctctgactcttaactggatctgcttcacacctag
GTCCCGACATCTGTGGCCCTGGCACCAAGAAGGTTCATGTCATCTTCAACTACAAGGGCA
AGAACGTGCTGATCAACAAGGACATCCGTTGCAAG
gtgtgcctgggggtggtggcaaatggctgtcatggggagattcagaggtcagcctcattg
gggggtggcccccgctcaccttcttccttcttcaggatgatgagtttacacacctgtaca
cactgattgtgcggccagacaacacctatgaggtgaagattgacaacagccaggtggagt

Exon  5 +       2835       3050   0   Internal    216    94   Excellent
ctgtggccctggcaccaagaaggttcatgtcatcttcaactacaagggcaagaacgtgct
gatcaacaaggacatccgttgcaaggtgtgcctgggggtggtggcaaatggctgtcatgg
ggagattcagaggtcagcctcattggggggtggcccccgctcaccttcttccttcttcag
GATGATGAGTTTACACACCTGTACACACTGATTGTGCGGCCAGACAACACCTATGAGGTG
AAGATTGACAACAGCCAGGTGGAGTCCGGCTCCTTGGAAGACGATTGGGACTTCCTGCCA
CCCAAGAAGATAAAGGATCCTGATGCTTCAAAACCGGAAGACTGGGATGAGCGGGCCAAG
ATCGATGATCCCACAGACTCCAAGCCTGAGGTTGGT
gtttgggcaggggctctgctctccacattggagggtgtggaagacatctgggccaactct
gatctcttcatctaccccccaggactgggacaagcccgagcatatccctgaccctgatgc
taagaagcccgaggactgggatgaagagatggacggagagtgggaacccccagtgattca

Exon  6 +       3133       3246   0   Internal    114   100   Excellent
cacccaagaagataaaggatcctgatgcttcaaaaccggaagactgggatgagcgggcca
agatcgatgatcccacagactccaagcctgaggttggtgtttgggcaggggctctgctct
ccacattggagggtgtggaagacatctgggccaactctgatctcttcatctaccccccag
GACTGGGACAAGCCCGAGCATATCCCTGACCCTGATGCTAAGAAGCCCGAGGACTGGGAT
GAAGAGATGGACGGAGAGTGGGAACCCCCAGTGATTCAGAACCCTGAGTACAAG
gtgagtttggggctctgagcagggctggggctcacagtggggagtgcaccaaccttactc
acccttcggtttccttctcccttctgcagggtgagtggaagccccggcagatcgacaacc
cagattacaagggcacttggatccacccagaaattgacaaccccgagtattctcccgatc

Exon  7 +       3336       3479   0   Internal    144   100   Excellent
ccctgaccctgatgctaagaagcccgaggactgggatgaagagatggacggagagtggga
acccccagtgattcagaaccctgagtacaaggtgagtttggggctctgagcagggctggg
gctcacagtggggagtgcaccaaccttactcacccttcggtttccttctcccttctgcag
GGTGAGTGGAAGCCCCGGCAGATCGACAACCCAGATTACAAGGGCACTTGGATCCACCCA
GAAATTGACAACCCCGAGTATTCTCCCGATCCCAGTATCTATGCCTATGATAACTTTGGC
GTGCTGGGCCTGGACCTCTGGCAG
gtgagacttggaggaaaaaggaggatccctggggtacctcaagtgcataagatcacccaa
gaggaaagggacagggtaggcaccccaggtgagtctgactcaaaaatggtacttcttgta
aacagtacttcctggtctgtccctgtgaagtcctcacagcaacccctttaaggttatact

Exon  8 +       6129       6221   0   Internal     93   100   Excellent
ggcgtgatccacctcacctggcctctccatctttttaactgcagtgtcagcggtgttcct
tgtcttctctgcagatgcaggcagcagaatatagtggttataggaacacaggtggaaacc
ctgtccaaagcaagggctatcgggtatcacctctgaccatccttcccattcatcctccag
GTCAAGTCTGGCACCATCTTTGACAACTTCCTCATCACCAACGATGAGGCATACGCTGAG
GAGTTTGGCAACGAGACGTGGGGCGTAACAAAG
gtgaggcctggtcctggtcctgatgtcgggggcgggcagggctggcagggggcaaggccc
tgaggtgtgtgctctgcctgcaggcagcagagaaacaaatgaaggacaaacaggacgagg
agcagaggcttaaggaggaggaagaagacaagaaacgcaaagaggaggaggaggcagagg

Exon  9 +       6305       6501   0   Internal    197   100   Excellent
ccaggtcaagtctggcaccatctttgacaacttcctcatcaccaacgatgaggcatacgc
tgaggagtttggcaacgagacgtggggcgtaacaaaggtgaggcctggtcctggtcctga
tgtcgggggcgggcagggctggcagggggcaaggccctgaggtgtgtgctctgcctgcag
GCAGCAGAGAAACAAATGAAGGACAAACAGGACGAGGAGCAGAGGCTTAAGGAGGAGGAA
GAAGACAAGAAACGCAAAGAGGAGGAGGAGGCAGAGGACAAGGAGGATGATGAGGACAAA
GATGAGGATGAGGAGGATGAGGAGGACAAGGAGGAAGATGAGGAGGAAGATGTCCCCGGC
CAGGCCAAGGACGAGCT
gtagagaggcctgcctccagggctggactgaggcctgagcgctcctgccgcagagctggc
cgcgccaaataatgtctctgtgagactcgagaactttcatttttttccaggctggttcgg
atttggggtggattttggttttgttcccctcctccactctcccccaccccctccccgccc

--------------------------------------------------------------------------------