--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (10381 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1720       1863   1   Internal    144    54    Marginal
ggggtccctcggaggcctcctggggatgggggctgcagctcgtctgagcgcccctcgagc
gctggtactctgggctgcactgggggcagcaggtaagacctggggttcccgggaggagcc
cccgagggagggtggaggtggggatgccaaggagagggattcaggctgctctcttcccag
CTCACATCGGACCAGCACCTGACCCCGAGGACTGGTGGAGCTACAAGGATAATCTCCAGG
GAAACTTCGTGCCAGGTGCCGCCAAGGCGGGGACCCAGGAGTCCGGCCCTCCCGGCGCCT
CCTTCTTCAGACTCAGGAACCTGG
gttcccagctccctcctcccccccaggaccaggagtcccagccccctcctctgtccctca
ggagtcgggccagcttctgaaccccaggggctcaccatgggacattatacatgcgcattt
caagtagtgagtgggagtgagtggaaggaaagtgtgggggtggagattatgtgtgtgttt

Exon  2 +       2628       2770   1   Internal    143    61    Marginal
tctaggacccagaattctggatctgagcccagtcctccctcagacccaggagtctaggtc
cctagcccctcctcccctgggatctgggagtccagaccacagcccactcagcagatacca
gccctgggatccagtctctatttctgactccttgtcctcctactccgaccccacccccag
GGCCTCCTTTCTGGGGCCTGGTGAATGCAGCGTGGAGTCTGTGTGCTGTGGGGAAGCGGC
AGAGCCCCGTGGATGTGGAGCTGAAGAGGGTTCTTTATGACCCCTTTCTGCCCCCATTAA
GGCTCAGCACTGGAGGAGAGAAG
gtaaggggcttggagggaggagctattgaacccactggggatgggcatgaatagaggctg
gggaatggggtgctgaggtaggagagcagccttgggggaggaggggacacccagtgggtg
gagaggaggctgcttacactgtaaaatggatcacccattcttcccatcccaagcatggtc

Exon  3 +       6917       7105   0   Internal    189    87        Good
ggaggttgcggtgagccgagatcacgccactgcactccagcctgggcaacaagagcgaga
ctccgtttcaaaaaaaaaaaaaaaaaaaaaaaagactgttggaatcagaaaatgtaggcg
tgggaaacgagagataaaagatctctccctgccccctgacagctcccgcctctcccacag
CTCCGGGGAACCTTGTACAACACCGGCCGACATGTCTCCTTCCTGCCTGCACCCCGACCT
GTGGTCAATGTGTCTGGAGGTCCCCTCCTTTACAGCCACCGACTCAGTGAACTGCGGCTG
CTGTTTGGAGCTCGCGACGGAGCCGGCTCGGAACATCAGATCAACCACCAGGGCTTCTCT
GCTGAGGTA
gtggccactgattgtttacccgccaccctccgccctgagtcaccccaattcctcccacct
caccctcttagtgtctcaccccatcctcctccacagaactggcctcccaccctaagcact
aatcctcagcctgattcgggcccccaaagctggggtcatgctctcctccccttctgctgg

Exon  4 +       7314       7409   0   Internal     96    95   Excellent
tccgccctgagtcaccccaattcctcccacctcaccctcttagtgtctcaccccatcctc
ctccacagaactggcctcccaccctaagcactaatcctcagcctgattcgggcccccaaa
gctggggtcatgctctcctccccttctgctgggggaccccatgctctgtgctacccccag
GTGCAGCTCATTCACTTCAACCAGGAACTCTACGGGAATTTCAGCGCTGCCTCCCGCGGC
CCCAATGGCCTGGCCATTCTCAGCCTCTTTGTCAAC
gtgagcggaggcgagattcagagggagggagcagttgggtgcctggaacccggggtctga
gggaagcggggtgctgggaggcccagactcctgggtcctgggggaggagaaggttgaggg
cttggacttctgggctcctgtgtcctcacctcgtacccccacacaggttgccagtacctc

Exon  5 +       7576       7648   0   Internal     73    62    Marginal
gcctctttgtcaacgtgagcggaggcgagattcagagggagggagcagttgggtgcctgg
aacccggggtctgagggaagcggggtgctgggaggcccagactcctgggtcctgggggag
gagaaggttgagggcttggacttctgggctcctgtgtcctcacctcgtacccccacacag
GTTGCCAGTACCTCTAACCCATTCCTCAGTCGCCTCCTTAACCGCGACACCATCACTCGC
ATCTCCTACAAGA
gtaagtccctggcgtgctgggggcagtggtcacacacgagggggttcaagagtgccatcc
ctctttactctggcctgatattcccgcagatgatgcctactttcttcaagacctgagcct
ggagctcctgttccctgaatccttcggcttcatcacctatcagggctctctcagcacccc

Exon  6 +       7738       7892   1   Internal    155   100   Excellent
cctcgtacccccacacaggttgccagtacctctaacccattcctcagtcgcctccttaac
cgcgacaccatcactcgcatctcctacaagagtaagtccctggcgtgctgggggcagtgg
tcacacacgagggggttcaagagtgccatccctctttactctggcctgatattcccgcag
ATGATGCCTACTTTCTTCAAGACCTGAGCCTGGAGCTCCTGTTCCCTGAATCCTTCGGCT
TCATCACCTATCAGGGCTCTCTCAGCACCCCGCCCTGCTCCGAGACTGTCACCTGGATCC
TCATTGACCGGGCCCTCAATATCACCTCCCTTCAG
gtgaccctctgtccgcaccgcccttcctaggcctgggtactccactcactggcctgggca
tccccttgctcacctgccctccctctcctcatagactgaactcaagtaggtaagagggtc
agaccaccttgggggtgggtggggctgagaacagaccccgcccacctgctcccaggggcg

Exon  7 +       8144       8309   0   Internal    166    97   Excellent
acctgccctccctctcctcatagactgaactcaagtaggtaagagggtcagaccaccttg
ggggtgggtggggctgagaacagaccccgcccacctgctcccaggggcggggtttcctgc
gtgacgtcaccaagaccattcactattcactcccagtttcccaccctccttccactgcag
ATGCACTCCCTGAGACTCCTGAGCCAGAATCCTCCATCTCAGATCTTCCAGAGCCTCAGC
GGTAACAGCCGGCCCCTGCAGCCCTTGGCCCACAGGGCACTGAGGGGCAACAGGGACCCC
CGGCACCCCGAGAGGCGCTGCCGAGGCCCCAACTACCGCCTGCATG
gtatggtccagtctgcaccccctctaagtcttgggctaaccctcttatatgtgtctcccc
ttggtgtctcagtgtgattcagtcccatcctccttcctgcgtctatatggtctagcctcg
tgagctgtctctttttctctctttccctacatgtctatgtggtacagtccacctgccagc

--------------------------------------------------------------------------------