--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (45361 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (26 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       4172       4339   0   Terminal    168    48    Marginal
acaccaccatgcctgggtactttttttttttttttttttttggtagagatagggttgcac
tgtgttggccaggctggtctcaaattccagacttaaggtgatccacctgccatggcctcc
caaagtgctgggattacaggcgtgagccactgtgcctggacaatctttgttttattacag
CAACTTGCTGATCAAGTGTTGCAGGCTGTGACACTGTTGAATATAGTGCAATCTGGTGTT
GAAATGATCAATTGCCTTGTGCTGATAGTTCCTGCAATGCCATCTGAGTTTACCATGACA
TCCCCAAGGCACCTGGGCACTCAGTTTGGGAACTACAGCATTGTCTAA
ccttgcttcatccttttcttctacactgggaacatgatatagggtttctgttggaagtag
atacaaaagtaggacatcaagttcgattatgtagccgcctttggattggaaacaataagc
gaaattcttttccttttccttgaccttcagctaactcttaacgtggtgaatggtggctcc

Exon  2 +       4490       4594   0   Terminal    105    52    Marginal
actcagtttgggaactacagcattgtctaaccttgcttcatccttttcttctacactggg
aacatgatatagggtttctgttggaagtagatacaaaagtaggacatcaagttcgattat
gtagccgcctttggattggaaacaataagcgaaattcttttccttttccttgaccttcag
CTAACTCTTAACGTGGTGAATGGTGGCTCCTGCTTTTTGGCCACAGGTCAGTATGAAAAT
GGAGAGGGAGCAGCAGTTTTTAATCTTTTCAACGGAAAACTTTGA
agatgttgtctcctgttatctatgccaggcatgccttctcttgccactgcctgcctgacc
cccaccacagaagcgcacacactcttcccccgcctctggtctcattctctgtcccttctt
cagagatgccgcctgtccctcgggtcagtgcagatccctctccccgtccatggccagagc

Exon  3 +       8628       8837   0    Initial    210    77        Good
gggacttgtcattctgagcggtgcccatctgctgactgatatctcacgggggctcttctc
ttcctttgtagagtgcctggtgaagaatgtgatgggatcactagcatgtctgcggagagc
ggccctgggacgagattgagaaatctgccagtaatgggggatggactagaaacttcccaa
ATGTCTACAACACAGGCCCAGGCCCAACCCCAGCCAGCCAACGCAGCCAGCACCAACCCC
CCGCCCCCAGAGACCTCCAACCCTAACAAGCCCAAGAGGCAGACCAACCAACTGCAATAC
CTGCTCAGAGTGGTGCTCAAGACACTATGGAAACACCAGTTTGCATGGCCTTTCCAGCAG
CCTGTGGATGCCGTCAAGCTGAACCTCCCT
gtgagtagtgtgggcagggcccagggtggccgtcctggaggtcgtctcctgcatgtctcc
tggtcagggcagttcctggggggagggtaggagatgcatttggaatcatggtgagagctg
cagggcccttgagtgagtggtttcagcagttctgatcagttgaaatcagggagaaagaat

Exon  4 +      12417      12521   0   Internal    105    66    Marginal
ttactaggtgaggattgctttttaaaaggctgcctggtttcccccttatttattaaaagt
gaaagaatattttagtatccataaaaagaaaaaatgtgcatttcaatgaaggcagcctat
ttcaagatagagtggttggaaacttgtacgtttccctctgaattactccccagcatccag
GAACCCTTCCCCGCTCCACTTTATTTTGGTGTTCCCCCTCAAGATCACTTGCTGATGCCA
GTAGGAGCTGTGGCTCCCGTGGATTTACCTGTGGAGCAGCCAGGG
gtgaggtccccaggccagcctggccagcccagcgtttgtgctgcctggctgcctaggtga
cactggacttttgctctctgctctccaggattactataagatcattaaaacgcctatgga
tatgggaacaataaagaagcgcttggaaaacaactattactggaatgctcaggaatgtat

Exon  5 +      12610      12747   0   Internal    138   100   Excellent
ctccactttattttggtgttccccctcaagatcacttgctgatgccagtaggagctgtgg
ctcccgtggatttacctgtggagcagccaggggtgaggtccccaggccagcctggccagc
ccagcgtttgtgctgcctggctgcctaggtgacactggacttttgctctctgctctccag
GATTACTATAAGATCATTAAAACGCCTATGGATATGGGAACAATAAAGAAGCGCTTGGAA
AACAACTATTACTGGAATGCTCAGGAATGTATCCAGGACTTCAACACTATGTTTACAAAT
TGTTACATCTACAACAAG
gtgagatgtaggggtgggtgtccagctgccctggggagagaggaggggaggcgacggcag
tgggcatgtcaggagcccgtgggcaggggtgttgggtgtggctgggcttggagtctggca
agaggagacccttggaggtagaggtaatgagacctgtggttgttcctgtgactgggtgtg

Exon  6 +      14101      14218   0   Internal    118    84        Good
caagcctctgtgatacctggtagtgtagccattgtggctcctttgggtgcagatcgggga
aggacccggaatacgacgcttcatgttttgggggcagggggtgggtggcatggggtgccc
tgtctacagaggtggggaggggagggccctctgactctacccctgtgtctccttatccag
CCTGGAGATGACATAGTCTTAATGGCAGAAGCTCTGGAAAAGCTCTTCTTGCAAAAAATA
AATGAGCTACCCACAGAAGAAACCGAGATCATGATAGTCCAGGCAAAAGGAAGAGGAC
gtgggaggaaagaaacaggtagagtactgaaatagcaagtaaattggctttctccccgac
ctttgtcccttttccaagtttggtggggggctgggagtggcaggaggatgtgacattata
tactgcatgccgtgttggtgtttggacatgtgagattgggtttggtgttggatccatccc

Exon  7 +      14808      14893   2   Internal     86    83        Good
gaggtttgtgattggaattaccttaatgcactggtgtcagagttatccctgcttctgatg
ctcagtcatctgaagtgaaagccctcctcatccatctctgcctgtcaccacccccaactg
acacagggttccaggggccagctggcagagctgcccactctaggaaatgattctgtctag
GAAACTCTCCAGCAGCTACTGGCTACATCTTGTCCTTTGCAACTCCATGCTGCAGAAGGG
TGACATTTGCGAGGTGGTCCCTGAGT
gtgagttgtttgcttctctgagcagcagcctttcacctggcctcccatgctgttctgaag
tggtggcagaaagggggttgctacatcccctgctgcacccaaaggtaaccaaggagaact
agtctcacgtgtcaccctgtggctcttgtacctatcagatcacattcctgatcctcatgt

Exon  8 +      15332      15423   1   Terminal     92    45    Marginal
gacagacgtggtggcatctcctattccagtctgggagaagcccaggagttgtgcctgagg
aaggagaattgggaaactcagcagaatctcacccttgctccttgagatgcacagggaaca
tgggtgctgcttgagctgatagatgaaggcactgggtgtctttgtccattttcatggcag
CCAGCATGCACACGAAGGATGTGGTGACCCAGGTTATGCTCCTAGACATTCTCACCCTGG
TCCACCCAGTTTTGTTAGAGCTCTGGCCATAA
cccctcactttttgcagctggttgggtgtgccacgtgaccattgtgtgttcggactgcct
gcacagctgctgggaggcagcgctcgagccagtcatgaagggcagcagtccagctgcccc
ctgtggttccaggaggtgggggcctgccagtttccagaaaccttggcaagggcggctact

Exon  9 +      16886      17248   0   Internal    363    88        Good
gagcagagtggtgggacacgatctgcctgtccttggccctttgcctgtgcaattatcttt
gggtccattctgtgtgagcgatgggccccaagacagggcctggctttgggggtgaccctg
agggcagctgtgccggctgccacttctgactgtgcctgttggcgtccgtgttcttggcag
ACAAAGAAGGGAGTGAAGAGGAAAGCAGACACCACCACCCCCACCACCATTGACCCCATT
CACGAGCCACCCTCGCTGCCCCCGGAGCCCAAGACCACCAAGCTGGGCCAGCGGCGGGAG
AGCAGCCGGCCTGTGAAACCTCCAAAGAAGGACGTGCCCGACTCTCAGCAGCACCCAGCA
CCAGAGAAGAGCAGCAAGGTCTCGGAGCAGCTCAAGTGCTGCAGCGGCATCCTCAAGGAG
ATGTTTGCCAAGAAGCACGCCGCCTACGCCTGGCCCTTCTACAAGCCTGTGGACGTGGAG
GCACTGGGCCTACACGACTACTGTGACATCATCAAGCACCCCATGGACATGAGCACAATC
AAG
gttagcgggatgtgcctgagggaagggacaaggtgggcaggctgtccctccacatcagaa
ccttcctagaccttttagtccaagaggaagcccaggccctggaacggtggctgcgtggat
ttttcccgccaactcgaagaaactcagcgccccctgctgtctgctgtgggacgtgctctg

Exon 10 +      18104      18232   0   Internal    129   100   Excellent
ccagtcccagccctgaggctgagaactggggtgatggcctgtccccccactagagtcttg
accaaactgagagccaagaaaccaacttgctcttctaggcatccctttcgtctgctgcca
gccacttctccatggtcacatgggcagacacagctaacagggacttgtcttgttttccag
TCTAAACTGGAGGCCCGTGAGTACCGTGATGCTCAGGAGTTTGGTGCTGACGTCCGATTG
ATGTTCTCCAACTGCTATAAGTACAACCCTCCTGACCATGAGGTGGTGGCCATGGCCCGC
AAGCTCCAG
gtgaggcttgggagggcgcagccaccctcagcagagcaggctgaggtcctcgtgggagca
gacttctgtgggccttggcagagtttttttttctgtcactttccttgggataatgccatg
ttgctttagaaaagtgcctaaagtcagcctagtgcatacattttaagttggggttattca

Exon 11 +      21998      22110   0   Internal    113    61    Marginal
ccccttgctgcccatgtgttcattcacctttctgtttccagctagactgagctccttgaa
cagggagctcgtcattcctgtctaccatcaagctggtacttggagacttgtgactgttga
agccacacagcaaggttttcctacagcagccctgggcccactggcttgtgggtttcccag
GATGCCCCCCACTCAGGCTACAACAAGAGTTCTCACATCCAAGAGACAGGGAAGGATGAC
AGGGTCACACAACTGGACACGCCAGGAAGCTGGCAGTTCCCAGTCCCACCAAT
gttagtttctcatcttagctgactttgtgtcttgtattttttgctctttgttgttggggc
ctttggagagccagggccatgagcacccagggaatggaaggaggcctcagagtgaatgcc
acacacccccaccccagcatttacccaacagtcatcacctggtggggaggaacaaggaca

Exon 12 +      24479      24688   0   Internal    210   100   Excellent
ttgtcagaggcccttggctggcccttgcccctgtctcggcagcaaagagacaggatcacc
atcctctttcgccctcggttgctttctgttgagttggccccagcagccaatgagggcagg
tgatgctaggccgcggcctgggtacccagcagccgtcacagcatgtctttccctcaccag
GATGTGTTCGAAATGCGCTTTGCCAAGATGCCGGACGAGCCTGAGGAGCCAGTGGTGGCC
GTGTCCTCCCCGGCAGTGCCCCCTCCCACCAAGGTTGTGGCCCCGCCCTCATCCAGCGAC
AGCAGCAGCGATAGCTCCTCGGACAGTGACAGTTCGACTGATGACTCTGAGGAGGAGCGA
GCCCAGCGGCTGGCTGAGCTCCAGGAGCAG
gtgagggcattggtggctccattcttaatccccagagtccgtggaccagggtggcctccc
cagaagtttctaagagatgttcttggttctgagttcccaagggagcataattcccactgg
accacctgtggccttttcccctttgctaggtcaaatgcatgttgatcatacacgtatgta

Exon 13 +      25389      25588   0   Internal    200   100   Excellent
aatctggttaacatgacaggcgcaaagctgggggccttcccttcccctgcctcccctatg
cccacaccctgatgccccaggtgcatgctgtcgcatgttttttggagcagacgcctgggt
cttgggtgacaggaaggtggtttcagccctgagtgtgtgtcttgcctgtctggtctacag
CTCAAAGCCGTGCACGAGCAGCTTGCAGCCCTCTCTCAGCCCCAGCAGAACAAACCAAAG
AAAAAGGAGAAAGACAAGAAGGAAAAGAAAAAAGAAAAGCACAAAAGGAAAGAGGAAGTG
GAAGAGAATAAAAAAAGCAAAGCCAAGGAACCTCCTCCTAAAAAGACGAAGAAAAATAAT
AGCAGCAACAGCAATGTGAG
gtctgtgtcccctgaatttgtcctgggtggggaccctccttccagggcttgctctgagac
tgtgtgggccactgcccctccctgtcctcattgggtgcggaggctgcccctctgcagccg
tggcttcacaggccaggctggtggccacttgcacacaggacttagctgcactgtctctgc

Exon 14 +      26060      26355   2   Internal    296    93   Excellent
gcttcggtctccactgggtgctcccagagattgagttgcccatgccccgtttcctgtgaa
ggctggtgggtggggggtatgggaagggcaccccttccccccaacatacatgtggaggaa
tgagtgcctggcttcctcagggggcccgttcttgatggtgtctgcatcgtcccttcgtag
CAAGAAGGAGCCAGCGCCCATGAAGAGCAAGCCCCCTCCCACGTATGAGTCGGAGGAAGA
GGACAAGTGCAAGCCTATGTCCTATGAGGAGAAGCGGCAGCTCAGCTTGGACATCAACAA
GCTCCCCGGCGAGAAGCTGGGCCGCGTGGTGCACATCATCCAGTCACGGGAGCCCTCCCT
GAAGAATTCCAACCCCGACGAGATTGAAATCGACTTTGAGACCCTGAAGCCGTCCACACT
GCGTGAGCTGGAGCGCTATGTCACCTCCTGTTTGCGGAAGAAAAGGAAACCTCAAG
gtgtgcttgggccccctgggcatggggttccttctgtgggcaccctcagagtaacttttc
cctccttgctcagtccactctttctgcgcccccccccttttttttttccaattataatat
ctgtgttcttgacacagaaacctccgaaaggttgtgacattgcactcacccctaggctgt

Exon 15 +      27369      27500   1   Internal    132    96   Excellent
attgtaagcagtctacccatgggaactgtgggaccacgtgggttctgggagtggcagctg
gcagttgggagcagcccctgggcccaccgtgcacaggctcctcactggtccttcctccag
atggatggggtgtgcccatggcttagagcggcttcctgggccacagccctgcctgaccag
CTCCCATTGCTTGGATTGCAGCTGAGAAAGTTGATGTGATTGCCGGCTCCTCCAAGATGA
AGGGCTTCTCGTCCTCAGAGTCGGAGAGCTCCAGTGAGTCCAGCTCCTCTGACAGCGAAG
ACTCCGAAACAG
gttaggtgacttgtgttctacgtgtcttaccaaactcttcccacctgtgcctggcactag
ctcggtcctgtgtccaggatgctagagcccagagacggcactcccagaacttgctgggtt
cctctgtctgtctgtctctttgttaactgtctccctggggccatgaatagccctgcactc

Exon 16 +      31867      32178   1   Internal    312    56    Marginal
ctttattccttagcctgtttctttttcttttttttctcctcctcaacagtgtatataata
ggttctgctttttagagtttgagctttttgtttgggggatctggaggaatgcagagatga
ggctgtttgctctttcccctccactgggggtcctgcattctggtacctcctttcttgtag
ACCCAGGAGGAAGGGCTGGCATCGCCTTCCTGAGACTAGACAGTGCACAGCCCCTGGGTG
AGATGAGCTCAGAGTCAGCAGGGGCCTGGTGGGCTTGCCACACCTGGCTGGTGGGACAGG
GCAGGGGCATCACTCAAATTCAAAAGAAGCCACTTGAGGGCAGTAAAGGAAATGCCGGCG
TGCGCTCAGGCAGGGCACACGTGGAGCTTGCTAGTGGGAACCAGGGCCACTCTCTAGAAG
CTGAGCAGGCTGGGGGCGGTTTCCAAGGCATCCATGCATTCTGCCTCTGTGACCTTTCTA
AGCGGGCGGTGG
gtctgtccctacccagggttagccaggcacggggcagggctccagtctccagtgccgttc
ttgtgcccatcagccaccagggcgcaggaggttggctcagtctgcggttcttctgttctt
gtgacttaaatggtacattccacaccatttctctcacactggtttctctctccctctacg

Exon 17 +      36047      36175   1   Internal    129    62    Marginal
caaaaggcgccataccatgggcccggcctcccatctggtggcaggcgactgtgacctgcc
agcccatgagcactggccagggctcatgtccccctgtggggcttgtacaccatccatgtt
tggtgaggggacatccaactggcaaaagtcccttagtgtaaatctctggggtgaggacag
AGGTGGGCACGCTGGCTCTCGAGTACACCTCTCAGGGGCAGACACACCCTGGACCCATCC
ACCCTACTGTGGTGCCAAGCCGTCGGCCCACACGAGTGGGGGCGTATGCTGCCTTCTGTC
TGCAGCATG
gtgactgtgtcccaaagcagggacttctgaggtccatctacctctttagtagctggtcat
tcccaggaggccagcctgctccttttttttctcccggagtgggctctctgtgttttccct
tgccgatatgttcctcaccgtcctgtggctctcagccccagctgagcctctctgcttccc

Exon 18 +      36477      36564   2   Internal     88    82        Good
gccgatatgttcctcaccgtcctgtggctctcagccccagctgagcctctctgcttccct
ttggaggatggaaaggagtgggccttagagggccatgcagttggaggcccccgagaagct
gctttttagccatgtgaccctggacaagtcccctcccttctgaagccccacttttctcag
CTGTAAGATGAATGTGACCATTGCAACCATCACAGGTTGTTGGAAAACTGAGCAGGTTGC
TGTCCAGGCCATGCACTCAGTCACTATA
gtgagtgactgacccttgagtagtgggaggcgttgggcaagctctcagcttccggtgcaa
ccgtggtgatctgaagcttggcaggggaggctttttcaggcacagtccctgctaggaaaa
gcagcaggcaagtgggtaggtgatgcctcgcatgtctctccctctcccgtgatgaccaac

Exon 19 +      37052      37421   0   Internal    370    74        Good
ttctcttttcctctgcagagatggctccgaagtcaaaaaagaaggggcaccccgggaggg
agcagaagaaggtacatgggctcaggggcatccttcattaggtgggacgttgggtctggc
ccgggccagttctgcctgcctgacatcagcctgtctgtctgtctgtctctctgtctgcag
CACCATCATCACCACCATCAGCAGATGCAGCAGGCCCCGGCTCCTGTGCCCCAGCAGCCG
CCCCCGCCTCCCCAGCAGCCCCCACCGCCTCCACCTCCGCAGCAGCAACAGCAGCCGCCA
CCCCCGCCTCCCCCACCCTCCATGCCGCAGCAGGCAGCCCCGGCGATGAAGTCCTCGCCC
CCACCCTTCATTGCCACCCAGGTGCCCGTCCTGGAGCCCCAGCTCCCAGGCAGCGTCTTT
GACCCCATCGGCCACTTCACCCAGCCCATCCTGCACCTGCCGCAGCCTGAGCTGCCCCCT
CACCTGCCCCAGCCGCCTGAGCACAGCACTCCACCCCATCTCAACCAGCACGCAGTGGTC
TCTCCTCCAG
gtgagccgtggcctgccccagtgtgggttgagaccccttcctgcctcggtttacccatgt
ggtgtccgagcactctggctgggcagcttcttagcctcagctgctctggtctctagaggg
aagatctgtggcttctcgaggccatcttggaagttaaaggagatgcctcaagacaggtca

Exon 20 +      38657      38752   1   Internal     96    62    Marginal
ctgtgcagcagcagctgcagcagcagccgccaccacccccaccaccccagccccagcctc
caccccagcagcagcatcagccccctccacggcccgtgcacttgcagcccatgcagtttt
ccacccacatccaacagcccccgccaccccagggccagcagcccccccatccgcccccag
GCCAGCAGCCACCCCCGCCGCAGCCTGCCAAGCCTCAGCAAGTCATCCAGCACCACCATT
CACCCCGGCACCACAAGTCGGACCCCTACTCAACCG
gtaagtggtcctcacccgtagactctggggaggctggtgctgggcctatagttttgtcct
caggaagccagaagggttaactcatgcttcaggctgcagtgggttcagagctgagcctca
gcttggagggggacctggaagggtcattggtgcttcctacagtgtgtgtttatcaggtgt

Exon 21 +      41630      41742   1   Internal    113    92   Excellent
caggcccagtcacttgtgtgggtcttcaccctttttgagctgggctaatggacccttgtc
ccagggcctgggcggcacatgcagtttctccatacagcccacgttttccttcccgacaat
tctctcagggccagcagttctaagccagccccttgacacattccttgtcccttctcctag
GTCACCTCCGCGAAGCCCCCTCCCCGCTTATGATACATTCCCCCCAGATGTCACAGTTCC
AGAGCCTGACCCACCAGTCTCCACCCCAGCAAAACGTCCAGCCTAAGAAACAG
gtaactggcagggctgggccatagtcctgtgggctagggccgggggtgcctgcccacctc
accggccgctgtgcctgtgccatcccaggagctgcgtgctgcctccgtggtccagcccca
gcccctcgtggtggtgaaggaggagaagatccactcacccatcatccgcagcgagccctt

Exon 22 +      41831      41993   0   Internal    163   100   Excellent
ccccgcttatgatacattccccccagatgtcacagttccagagcctgacccaccagtctc
caccccagcaaaacgtccagcctaagaaacaggtaactggcagggctgggccatagtcct
gtgggctagggccgggggtgcctgcccacctcaccggccgctgtgcctgtgccatcccag
GAGCTGCGTGCTGCCTCCGTGGTCCAGCCCCAGCCCCTCGTGGTGGTGAAGGAGGAGAAG
ATCCACTCACCCATCATCCGCAGCGAGCCCTTCAGCCCCTCGCTGCGGCCGGAGCCCCCC
AAGCACCCGGAGAGCATCAAGGCCCCCGTCCACCTGCCCCAGC
gtgagtgctctccctgcccacagccagggctcaggccccccgaggcccgtgttggacata
agcttgctgtggggctggtggaccatgccccactggggtgaggtgggccagggcccaccg
gctgtttatgttccagggccggaaatgaagcctgtggatgtcgggaggcctgtgatccgg

Exon 23 +      42130      42260   1   Internal    131    51    Marginal
caagcacccggagagcatcaaggcccccgtccacctgccccagcgtgagtgctctccctg
cccacagccagggctcaggccccccgaggcccgtgttggacataagcttgctgtggggct
ggtggaccatgccccactggggtgaggtgggccagggcccaccggctgtttatgttccag
GGCCGGAAATGAAGCCTGTGGATGTCGGGAGGCCTGTGATCCGGCCCCCAGAGCAGAACG
CACCGCCACCAGGGGCCCCTGACAAGGACAAACAGAAACAGGAGCCGAAGACTCCAGTTG
CGCCCAAAAAG
gttgggatggaggtccatgggtgtcgcttgccccttggccctggaaggtgccatgctggg
cacacccccagctatgccctttaggcacagcagacccctcacccaccccaacctctctgt
tctgcaggacctgaaaatcaagaacatgggctcctgggccagcctagtgcagaagcatcc

Exon 24 +      42388      42593   0   Internal    206   100   Excellent
ctgacaaggacaaacagaaacaggagccgaagactccagttgcgcccaaaaaggttggga
tggaggtccatgggtgtcgcttgccccttggccctggaaggtgccatgctgggcacaccc
ccagctatgccctttaggcacagcagacccctcacccaccccaacctctctgttctgcag
GACCTGAAAATCAAGAACATGGGCTCCTGGGCCAGCCTAGTGCAGAAGCATCCGACCACC
CCCTCCTCCACAGCCAAGTCATCCAGCGACAGCTTCGAGCAGTTCCGCCGCGCCGCTCGG
GAGAAAGAGGAGCGTGAGAAGGCCCTGAAGGCTCAGGCCGAGCACGCTGAGAAGGAGAAG
GAGCGGCTGCGGCAGGAGCGCATGAG
gtgggcgggtgtctgggtggggcatggggactcttggggccacaccagtccccaggctga
ctgggaccctctgcccaggagccgagaggacgaggatgcgctggagcaggcccggcgggc
ccatgaggaggcacgtcggcgccaggagcagcagcagcagcagcgccaggagcaacagca

Exon 25 +      42388      42951   0   Terminal    564   100   Excellent
ctgacaaggacaaacagaaacaggagccgaagactccagttgcgcccaaaaaggttggga
tggaggtccatgggtgtcgcttgccccttggccctggaaggtgccatgctgggcacaccc
ccagctatgccctttaggcacagcagacccctcacccaccccaacctctctgttctgcag
GACCTGAAAATCAAGAACATGGGCTCCTGGGCCAGCCTAGTGCAGAAGCATCCGACCACC
CCCTCCTCCACAGCCAAGTCATCCAGCGACAGCTTCGAGCAGTTCCGCCGCGCCGCTCGG
GAGAAAGAGGAGCGTGAGAAGGCCCTGAAGGCTCAGGCCGAGCACGCTGAGAAGGAGAAG
GAGCGGCTGCGGCAGGAGCGCATGAGGTGGGCGGGTGTCTGGGTGGGGCATGGGGACTCT
TGGGGCCACACCAGTCCCCAGGCTGACTGGGACCCTCTGCCCAGGAGCCGAGAGGACGAG
GATGCGCTGGAGCAGGCCCGGCGGGCCCATGAGGAGGCACGTCGGCGCCAGGAGCAGCAG
CAGCAGCAGCGCCAGGAGCAACAGCAGCAGCAGCAACAGCAAGCAGCTGCGGTGGCTGCC
GCCGCCACCCCACAGGCCCAGAGCTCCCAGCCCCAGTCCATGCTGGACCAGCAGAGGGAG
TTGGCCCGGAAGCGGGAGCAGGAGCGAAGACGCCGGGAAGCCGTGAGTCTGGAGGCCTGG
TGGGGACCCTGGTCTAAGGATTAG
ctcctgagggagctgggaaagggggactggagcctggacagggaggggcagcgggggagc
cccgtccctgctggtcggcatgtggtcctctggactcagctgtagggccctgagtgctgt
gtggacggggtgagcgctatgaggggtcagccacggggagggctacggggctgactgctg

Exon 26 +      44086      44162   2   Internal     77    95   Excellent
ccatggcatccggagcgaggcgactgtcctgcgtgggtagccctcggccggggagtgagg
ccaccaaccaaagtcagttccttcccacctgtgtttctgtttcgtttttttttttctttt
ttttctatatatattttttgttgaattctattttatttttaattctctcttctcctccag
ACACAATGGCACTGCTTATCTCCGAAATGGTGTGATCGTCTCCTCATTGAGCAGCGGCTG
CCACCGCGCTGTGGGTA
gtgtgtgaccgtggctgtactgtatagtgaacatagttggcatatctttgtttgaagttt
gttggtgactccaccaaactggtgtgaaaaaagaaaaaagctcaaaaaaatccacaaaaa
gacaaaacacacaaaaaaaatcctgcctatattttactcagtttcaaactttattagtct

--------------------------------------------------------------------------------