--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (18343 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (8 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       5512       5691   0    Initial    180    89        Good
attgggccgcagacaagggatgaaactgcatgtcccagaatcctccagggtgacaggtcc
ttcttctctatgggtctgaggcccagggcttcatgggagttgtagtttttcagctgggag
gttgtggccagattctaggatacccctgtctttcctcaggctgcagacctgcagctggaa
ATGACACAGAAGCCTCATAAGAAGCCTGGCCCCGGCGAGCCCCTGGTGTTTGGGAAGACA
TTTACCGACCACATGCTGATGGTGGAATGGAATGACAAGGGCTGGGGCCAGCCCCGAATC
CAGCCCTTCCAGAACCTCACGCTGCACCCAGCCTCCTCCAGCCTCCACTACTCCCTGCAG

gtggcatggcggccggcctctctccctgtccctgtctgcatctcctcctccttgctgtgt
ctcttgccaggtgtacctctcttggtttgtttgttgtgtgtttctcctttctgtgcattc
accatttgttttctgaggccttccatgctccaggctcatgcttggtgatgctgggttccc

Exon  2 +      11911      12021   0   Internal    111    84        Good
tatatctgtctctctttttctccatctctctgacccagctgctaaatctccccggtgctc
tcctcttggcctccatctttcagttgtctgtgtctttgtgtatctgtctctgtctgtctt
ggtgtctctcatgactgtctggagaagtctctgagcctccccacccgcgtgtccccgcag
CTGTTTGAGGGCATGAAGGCGTTCAAAGGCAAAGACCAGCAGGTGCGCCTCTTCCGCCCC
TGGCTCAACATGGACCGGATGCTGCGCTCAGCCATGCGCCTGTGCCTGCCG
gtgaggggtcccggtccaccggggtggggaggagggctggggccggggcagcaagggccc
cttgactcattcagaatcccacccagagtttcgacaagctggagttgctggagtgcatcc
gccggctcatcgaagtggacaaggactgggtccccgatgccgccggcaccagcctctatg

Exon  3 +      12096      12227   0   Internal    132   100   Excellent
tgagggcatgaaggcgttcaaaggcaaagaccagcaggtgcgcctcttccgcccctggct
caacatggaccggatgctgcgctcagccatgcgcctgtgcctgccggtgaggggtcccgg
tccaccggggtggggaggagggctggggccggggcagcaagggccccttgactcattcag
AATCCCACCCAGAGTTTCGACAAGCTGGAGTTGCTGGAGTGCATCCGCCGGCTCATCGAA
GTGGACAAGGACTGGGTCCCCGATGCCGCCGGCACCAGCCTCTATGTGCGGCCTGTGCTC
ATTGGGAACGAG
gtgggcccaactccagggctgggaagctgggctgcgggggttggattctgcagggcaggg
gtggggtcctggaggcctgggcctggggacgggaagggactgggggcctggactcctgac
gctgtccctttgcccgtcgcagccctcgctgggtgtcagccagcccacgcgcgcgctcct

Exon  4 +      12370      12533   0   Internal    164    89        Good
ccagcctctatgtgcggcctgtgctcattgggaacgaggtgggcccaactccagggctgg
gaagctgggctgcgggggttggattctgcagggcaggggtggggtcctggaggcctgggc
ctggggacgggaagggactgggggcctggactcctgacgctgtccctttgcccgtcgcag
CCCTCGCTGGGTGTCAGCCAGCCCACGCGCGCGCTCCTGTTCGTCATTCTCTGCCCAGTG
GGTGCCTACTTCCCTGGAGGCTCCGTGACCCCGGTCTCCCTCCTGGCCGACCCAGCCTTC
ATCCGGGCCTGGGTGGGCGGGGTCGGCAACTACAAGTTAGGTGG
gtaagtagcacccccatccccagaacgactggcgcactgggcgttggagacacagggacc
agcgtgcgtgctttcggccatgcctctggatgtcacatgaaggtgacatcatcagcaccg
tgcagggctcagtgctaagtgacctccctggtccctgaaaacaaaccatggaaggaagga

Exon  5 +      14875      15059   2   Internal    185    98   Excellent
ataaccatttagggtcctgatgccaaatgaaaagtcaaggattccatctcaggggaactg
gggagccctgtgagagctgtgagcagggagacgggagagagtaggatgagcctcctctgg
ggctgggctggggaaggatggggctcccttgccccacccaaccagactgccctccaccag
GAATTATGGGCCCACCGTGTTAGTGCAACAGGAGGCACTCAAGCGGGGCTGTGAACAGGT
CCTCTGGCTGTATGGGCCCGACCACCAGCTCACCGAGGTGGGAACCATGAACATCTTTGT
CTACTGGACCCACGAAGATGGGGGTAAGCCCACCCATGACCCAGCCCGAACCCTGGTGGA
AGTGG
gtggcaccatcattcctggcaggttacaggccccagggattctgggatgggggaaggggg
tggctcttaagacggcggtgctagggggtgagaggtaacatcttccaccccttacacctg
ccctagtgctggagctggtgacgcccccgctgaatggtgttatcctgcctggagtggtca

Exon  6 +      15186      15271   1   Internal     86    53    Marginal
acgaagatgggggtaagcccacccatgacccagcccgaaccctggtggaagtgggtggca
ccatcattcctggcaggttacaggccccagggattctgggatgggggaagggggtggctc
ttaagacggcggtgctagggggtgagaggtaacatcttccaccccttacacctgccctag
TGCTGGAGCTGGTGACGCCCCCGCTGAATGGTGTTATCCTGCCTGGAGTGGTCAGACAGA
GTCTACTGGACATGGCTCAGACCTGG
gtgaggacatggcatcttctggtgatgggcgccatgtgccaggggccagggcatcagagg
gctgggactggggcacactggcatgtctctgccccttctcctgggtctgtctctcccgtt
gggcctctgtctttctcactatcctcagggagggagaggtggaggtctgcagcagggcaa

Exon  7 +      15490      15630   0   Internal    141   100   Excellent
ccaggggccagggcatcagagggctgggactggggcacactggcatgtctctgccccttc
tcctgggtctgtctctcccgttgggcctctgtctttctcactatcctcagggagggagag
gtggaggtctgcagcagggcaaccctctggggacacgtgtctctgccaactgccctgcag
GGTGAGTTCCGGGTGGTGGAGCGCACGATCACCATGAAGCAGTTGCTGCGGGCCCTGGAG
GAGGGCCGCGTGCGGGAAGTCTTTGGCTCGGGCACCGCTTGCCAGGTCTGCCCAGTGCAC
CGAATCCTGTACAAAGACAGG
gtgaggcggggctgccattgtgggtgggagggaaggaggggaggggcttggtcctcaccg
caccttctgtcccagaacctccacattcccaccatggaaaatgggcctgagctgatcctc
cgcttccagaaggagctgaaggagatccaggtgagctgcagggagctggggaatgggctg

Exon  8 +      15706      15858   0   Terminal    153    94   Excellent
aagcagttgctgcgggccctggaggagggccgcgtgcgggaagtctttggctcgggcacc
gcttgccaggtctgcccagtgcaccgaatcctgtacaaagacagggtgaggcggggctgc
cattgtgggtgggagggaaggaggggaggggcttggtcctcaccgcaccttctgtcccag
AACCTCCACATTCCCACCATGGAAAATGGGCCTGAGCTGATCCTCCGCTTCCAGAAGGAG
CTGAAGGAGATCCAGGTGAGCTGCAGGGAGCTGGGGAATGGGCTGGGAGCTTGTTCCCTG
GAGAAGTTGGTGTCCCATGAGCCCCTGGACTAA
cagccagcctccttcagtagtaccaggaacagataatggcctttcttattgaggccctgg
agagtgggctttctgtgctgctctgtggcctggaaaaccccttggggctaaatcaccctt
tcctgggagctcccggagccctggatatgtcttcagctttggaaaccccttcctgtgatc

--------------------------------------------------------------------------------