Gene TYMS Variant 1
DNA : 15.84 KbNT_010859
mRNA : 1529 bp NM_001071
CDS : 942 bp NP_001062
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  297 bp
ggtttcctaagactctcagctgtggccctgggctccgttctgtgccacacccgtggctcc
tgcgtttccccctggcgcacgctctctagagcgggggccgccgcgaccccgccgagcagg
aagaggcggagcgcgggacggccgcgggaaaaggcgcgcggaaggggtcctgccaccgcg
CCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCAC
TTCGCCTGCCTCCGTCCCCCGCCCGCCGCGCCATGCCTGTGGCCGGCTCGGAGCTGCCGC
GCCGGCCCTTGCCCCCCGCCGCACAGGAGCGGGACGCCGAGCCGCGTCCGCCGCACGGGG
AGCTGCAGTACCTGGGGCAGATCCAACACATCCTCCGCTGCGGCGTCAGGAAGGACGACC
GCACGGGCACCGGCACCCTGTCGGTATTCGGCATGCAGGCGCGCTACAGCCTGAGAG
gtgacgccgcgggcccctgcgggacgggtggcgggaaggagggaggcgcggctggggaga
gcgctcgggagctgccgggcgctgcggaccccgtttagtcctaacctcaatcctgcgagg
gaggggacgcatcgtcctcctcgccttacagacgccgaaacggagggtcccattagggac
EXON 2  74 bp
ggccactgatgggacttgcagcctgggagctccaccgtgatctctggcccactttgcggg
agtctaggctttctggatgctccagggcctcacgtcccagggcagttttcttccctgaag
aaagttggatggcatgatctgtcttcccatcttgaaaccgtatggcaaattgtttttcag
ATGAATTCCCTCTGCTGACAACCAAACGTGTGTTCTGGAAGGGTGTTTTGGAGGAGTTGC
TGTGGTTTATCAAG
gtaaagaagtcgctgctattagaagtcagtagtctgttctcaacacagcagccagtgaga
tcctttcaaaactcaaagcagccaggtgtggtggctcacgcctgtaatcccaccactttg
ggaggctgagtcagatcacctgaggttaggaatttgagaccagcctggccaacatggcga
EXON 3  175 bp
caagagcgaaactctcaaaaaacaaaaaaaaggatgggttccatatgggtggtgtcaagt
gcccacctcctagcaagtcagcaggggccagaggcccttgtaagtggtgtctcgggggga
tcaactgagatggcttaggatttacctggatgcctgctctgctctccccatctcttccag
GGATCCACAAATGCTAAAGAGCTGTCTTCCAAGGGAGTGAAAATCTGGGATGCCAATGGA
TCCCGAGACTTTTTGGACAGCCTGGGATTCTCCACCAGAGAAGAAGGGGACTTGGGCCCA
GTTTATGGCTTCCAGTGGAGGCATTTTGGGGCAGAATACAGAGATATGGAATCAG
gtgaggagatagaacaatgccttccatttcccgggtgcccttcctagcatgtgtttgctc
cgttgttttagataaggtctgggggatgagtcaatgtcacaggagctgatgtatagcttt
gaccttgtgaggggtggtgccaggttaagccacaattaagcctcatgaaggccgtttcac
EXON 4  102 bp
acagggccttgaactcaacccaccgagatctgcaaactttgcaggatgcaccagatgtct
tgtagccatgggtcaaggggggaccctgggtaagagactgtaatagatgacctctaaggc
catctcatgacatgtgtgattaatgtatgtacctgtcctctctttttgacaattctacag
ATTATTCAGGACAGGGAGTTGACCAACTGCAAAGAGTGATTGACACCATCAAAACCAACC
CTGACGACAGAAGAATCATCATGTGCGCTTGGAATCCAAGAG
gttgaaagaaccccgtcgtcttcatttatactaaccatactcttagagggaagcaatctg
gttttgtgcagaggcacctgagggaggcaggaccctgggaacttcccccagccacatggt
tgattgtgtgacgttgggcaagtcacattttgctgcactttcaccttcagatcatgaggt
EXON 5  176 bp
tctccctcagctccgtgccatcgctgcagaggctgttatggacatcactgcagcccagtg
gctctctctcctggtctccaccatatgagttggcttctgtttctctcctgttttactttg
cctttagctgtggtctttcaaaccaccatccctccttatcttcctctgctggttcctcag
ATCTTCCTCTGATGGCGCTGCCTCCATGCCATGCCCTCTGCCAGTTCTATGTGGTGAACA
GTGAGCTGTCCTGCCAGCTGTACCAGAGATCGGGAGACATGGGCCTCGGTGTGCCTTTCA
ACATCGCCAGCTACGCCCTGCTCACGTACATGATTGCGCACATCACGGGCCTGAAG
gtgggctgtctcgggaagggtgacttgccagcctaccacactgagctcttcagttcttta
atatgggaaaacaaattgcagagtttagtctctgattagcttttaaatttgatatgtgta
agtaagaaatgaaccagcttttactttgaaaccttcctcttctggaaggttttctggccc
EXON 6  72 bp
gagttcaataccagcctgggcaacataacaagatgctgttgctacaaaaaaatggaaaag
ctacactaaattatttttttaaaaaaagccttgcggtgtctgcatattctaatgttttta
aatgatgttttaaagaattgaaactaacatactgttctgctttctcccccgggtttatag
CCAGGTGACTTTATACACACTTTGGGAGATGCACATATTTACCTGAATCACATCGAGCCA
CTGAAAATTCAG
gtaagaattagatgttatacttttgggtttggtaccttctcttgataaaaggttgactgt
ggaacaggcatctgctcaatgctgtgtccaagataaagatgactgctccaaatgtggggc
ttcagtttagggagaagtggtgggcaggtgggcaggacaaggcaggcatctgcctcagca
EXON 7  633 bp
gagaacagctggttgcgctccaatcatgttacataacctacggcaaggtatcgacaggat
catactcctgtaaaatagaactttgttgatcacatcctgtgtacttgtttcacggacatg
aggagcaattacaacaggtcgtacaattatggcaaaataatggccttattttgtttttag
CTTCAGCGAGAACCCAGACCTTTCCCAAAGCTCAGGATTCTTCGAAAAGTTGAGAAAATT
GATGACTTCAAAGCTGAAGACTTTCAGATTGAAGGGTACAATCCGCATCCAACTATTAAA
ATGGAAATGGCTGTTTAGGGTGCTTTCAAAGGAGCTCGAAGGATATTGTCAGTCTTTAGG
GGTTGGGCTGGATGCCGAGGTAAAAGTTCTTTTTGCTCTAAAAGAAAAAGGAACTAGGTC
AAAAATCTGTCCGTGACCTATCAGTTATTAATTTTTAAGGATGTTGCCACTGGCAAATGT
AACTGTGCCAGTTCTTTCCATAATAAAAGGCTTTGAGTTAACTCACTGAGGGTATCTGAC
AATGCTGAGGTTATGAACAAAGTGAGGAGAATGAAATGTATGTGCTCTTAGCAAAAACAT
GTATGTGCATTTCAATCCCACGTACTTATAAAGAAGGTTGGTGAATTTCACAAGCTATTT
TTGGAATATTTTTAGAATATTTTAAGAATTTCACAAGCTATTCCCTCAAATCTGAGGGAG
CTGAGTAACACCATCGATCATGATGTAGAGTGTGGTTATGAACTTTAAAGTTATAGTTGT
TTTATATGTTGCTATAATAAAGAAGTGTTCTGC
attcgtccacgctttgttcattctgtactgccacttatctgctcagttccttcctaaaat
agattaaagaactctccttaagtaaacatgtgctgtattctggtttggatgctacttaaa
agagtatattttagaaataatagtgaatatattttgccctatttttctcattttaactgc