Gene SERPINB4 Variant 1
DNA : 6.99 KbNT_025028
mRNA : 1704 bp NM_002974
CDS : 1173 bp NP_002965
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  48 bp
ttaaaaaggaggtacaatggtagaactgtaatcctgtcctttgtcataaattttcatatt
cataaaggtgagtgttagcccgcttgtgaaatctgaagttgagtaacttcaaatactaac
cacagagggaaaggcagcaagaggagaggcataaatttaggatctcacccttcattccac
AGACACACACAGCCTCTCTGCCCACCTCTGCTTCCTCTAGGAACACAG
gtaagagcttcaagcctctccagcttaataacatgaattatttttgagaataataatgat
actgtgttctatatcatgcatctcctgcattctgtctgattatattttacttattctgcc
agagcaaaattaaaatacctatttcatctgatttgtcctttatctaaattgcttagttcc
EXON 2  191 bp
aggacattaatatatttaatatatgcacattgtagaaagattgaagcgttaaaaataaga
gaaaaactttaaatgtcaaaatctcacaacccagatatatcatttctttaagaaaattgt
actacaaaataccattccatttattaaagtcattctgacaggaatctgatgcttttccag
GAGTTCCAGATCACATCGAGTTCACCATGAATTCACTCAGTGAAGCCAACACCAAGTTCA
TGTTCGATCTGTTCCAACAGTTCAGAAAATCAAAAGAGAACAACATCTTCTATTCCCCTA
TCAGCATCACATCAGCATTAGGGATGGTCCTCTTAGGAGCCAAAGACAACACTGCACAAC
AAATTAGCAAG
gtagctatcagcatcattacgttgtcctgttgcagtttttctctggttccgtcggctagc
acgcagatggtaatagatgtggtggtctgatgggtagcacagggggctgtgcaggaattc
ccataactgtgagaccactgacttaaacagatcttttgagtaaagttttcttgtcccgct
EXON 3  57 bp
attacgttgtcctgttgcagtttttctctggttccgtcggctagcacgcagatggtaata
gatgtggtggtctgatgggtagcacagggggctgtgcaggaattcccataactgtgagac
cactgacttaaacagatcttttgagtaaagttttcttgtcccgcttcatgtctcttccag
GTTCTTCACTTTGATCAAGTCACAGAGAACACCACAGAAAAAGCTGCAACATATCAT
gtgagtcacagagcactatggttcagctttagatccctgaacaggtcatagtttaaacct
ggaacttcacaaaaactaagaaaaggccagttttagggaaaatcttggacacaaagattg
agacatacagagtgggttggcatttcatggcacataattattattcctcatttctgcgtt
EXON 4  129 bp
gtcaaatataaggtggattttgaagggtatttgaggtgaaatacaccaattatcagggaa
taacatcaaaggtcctcaatgagactaccagcatttagggactgatctaacagacttagc
atgggtttagtatttacattgatacagcaattgaatgatctccctttttgatgtttgaag
GTTGATAGGTCAGGAAATGTTCATCACCAGTTTCAAAAGCTTCTGACTGAATTCAACAAA
TCCACTGATGCATATGAGCTGAAGATCGCCAACAAGCTCTTCGGAGAAAAGACGTATCAA
TTTTTACAG
gtaatttcacctggcctacccacatttcatttgcatcctgatgtctgtgtctctgagtgg
ccaaatggaagaaagcaaggcagatgagcctggccgactcaggtggagagcatttactca
gagtgcattagctccatttccacaactctcccccactggagtgtcccagaccccaacgat
EXON 5  118 bp
agcccacattccccttttgcattgcctacatgacacctgtataaaaatatccatggacag
gagatactgcatctattcagggtctggattcagcttactgttgttacaaataagtaagtt
tggtaatatatagttacataaattactcctaattcctacttcttccttcatatctcaaag
GAATATTTAGATGCCATCAAGAAATTTTACCAGACCAGTGTGGAATCTACTGATTTTGCA
AATGCTCCAGAAGAAAGTCGAAAGAAGATTAACTCCTGGGTGGAAAGTCAAACGAATG
gtaggagagccacccattatagaaacacctttgagaaacctatgccagtgagccttgtgc
ttgacactgcatgggggaacaggtgtggggattgagatgggtttgcagggagggctgaag
agggcactccagatgaaggatttgtccaaatgaatatgaagagagcctaggggagccaag
EXON 6  143 bp
gaaagctgcatctggtgaaccactggtcagtgagtctaacaattcaaagatcaaagtcag
tgagtctcaagcagggatttgggtcaataattaacgatcagtcacgaacatttgcaaagc
atcttccagacaagccatttgtagcttgtgtaaaagactcttttattctttcccttgcag
AAAAAATTAAAAACCTATTTCCTGATGGGACTATTGGCAATGATACGACACTGGTTCTTG
TGAACGCAATCTATTTCAAAGGGCAGTGGGAGAATAAATTTAAAAAAGAAAACACTAAAG
AGGAAAAATTTTGGCCAAACAAG
gtattgtctatattttatttatatagtgtaatatgttaatacatggaatgttaaacattt
ctgatggaatgtaacatgataagtaaaaaataaaaattgttcatgtctgttattttgttg
ttttactcttataactttatttagttaggaatacctgaaaaactattgtttctaactcat
EXON 7  156 bp
tttgttgttttactcttataactttatttagttaggaatacctgaaaaactattgtttct
aactcatggaattcctgggttatttcttagaagaagaaggatgtgttgctatctcaataa
tattatcttttttgtcttgtgtttcacgtgttatttgttggacacattgatttattgcag
AATACATACAAATCTGTACAGATGATGAGGCAATACAATTCCTTTAATTTTGCCTTGCTG
GAGGATGTACAGGCCAAGGTCCTGGAAATACCATACAAAGGCAAAGATCTAAGCATGATT
GTGCTGCTGCCAAATGAAATCGATGGTCTGCAGAAG
gtaagaacttgcatctacaactcttccttctactgccggacatttttccaaagataccaa
gtttaaacaaggtaaaagcttatgaccgagttgcctcaaaatgatgaaaaattctaaatg
aggaatgatgactcaccttcatattacaaatatttgagcatagggcctgacacaaactga
EXON 8  862 bp
atgtatttatatattcaggactcatattttacctattagaataataatgtctattaaagt
gaaccttctgtatttcacatttattgccaaaataacgaatctccacatagtcaattcatt
gttaaggtgtattagagatcgacagttagtcatatcagtttcttttttccatttgtatag
CTTGAAGAGAAACTCACTGCTGAGAAATTGATGGAATGGACAAGTTTGCAGAATATGAGA
GAGACATGTGTCGATTTACACTTACCTCGGTTCAAAATGGAAGAGAGCTATGACCTCAAG
GACACGTTGAGAACCATGGGAATGGTGAATATCTTCAATGGGGATGCAGACCTCTCAGGC
ATGACCTGGAGCCACGGTCTCTCAGTATCTAAAGTCCTACACAAGGCCTTTGTGGAGGTC
ACTGAGGAGGGAGTGGAAGCTGCAGCTGCCACCGCTGTAGTAGTAGTCGAATTATCATCT
CCTTCAACTAATGAAGAGTTCTGTTGTAATCACCCTTTCCTATTCTTCATAAGGCAAAAT
AAGACCAACAGCATCCTCTTCTATGGCAGATTCTCATCCCCATAGATGCAATTAGTCTGT
CACTCCATTTAGAAAATGTTCACCTAGAGGTGTTCTGGTAAACTGATTGCTGGCAACAAC
AGATTCTCTTGGCTCATATTTCTTTTCTATCTCATCTTGATGATGATAGTCATCATCAAG
AATTTAATGATTAAAATAGCATGCCTTTCTCTCTTTCTCTTAATAAGCCCACATATAAAT
GTACTTTTCCTTCCAGAAAAATTTCCCTTGAGGAAAAATGTCCAAGATAAGATGAATCAT
TTAATACCGTGTCTTCTAAATTTGAAATATAATTCTGTTTCTGACCTGTTTTAAATGAAC
CAAACCAAATCATACTTTCTCTTCAAATTTAGCAACCTAGAAACACACATTTCTTTGAAT
TTAGGTGATACCTAAATCCTTCTTATGTTTCTAAATTTTGTGATTCTATAAAACACATCA
TCAATAAAATAATGACATAAAA
tcatttttgctttacctgttttctctctggaaagggcaagtgtccagttacacataggaa
agataatttagagatatattaatcatatataaaggaaaattaaaaacagagtagttcatg
atgagcctggagtagaaggcatatcccagaacaggaggagccttgtaaaccacataggaa