Gene SERPINB2 Variant 1
DNA : 16.18 KbNT_025028
mRNA : 1901 bp NM_002575
CDS : 1248 bp NP_002566
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  63 bp
tcccccaaaatttcttaaaccatgcctttacaaacaagtatttctattctaatgatgtct
tcctgagtaaaatgttgaatcactcaaaggacacagatcaaaagacagagggagaaaaaa
aaatgccatgtgggaggggcaaagctgtataaaaccagtcattaccatgtctgaactgta
ACAACTCTCAGAGGAGCATTGCCCGTCAGACAGCAACTCAGAGAATAACCAGAGAACAAC
CAG
gtatttcaatgatttccatgccatgtctatgggaaatagggtttcatgttttctcttccc
tcatgctggtattaatagattgaaaatttggatgtggggtgtttgtagagggcgagtaaa
atttaagtggtgttttcttgtttagttgttgaattgaaaatattttatttcaagatttga
EXON 2  177 bp
ggctgcacaggtggtatgtccatgaagctgtccctgacctgcctcatgttgttccatgag
gaagaacagacagggaatctgtccctacacagaatgcagcctgtcctactgttgctgacc
tcacccaaaatgttaccttatgtttcagagctgtttttttcttcctctctttgcttctag
ATTGAAACAATGGAGGATCTTTGTGTGGCAAACACACTCTTTGCCCTCAATTTATTCAAG
CATCTGGCAAAAGCAAGCCCCACCCAGAACCTCTTCCTCTCCCCATGGAGCATCTCGTCC
ACCATGGCCATGGTCTACATGGGCTCCAGGGGCAGCACCGAAGACCAGATGGCCAAG
gtgagtttgagctgaagctccacatttgggccgagtagttcctgaatggaattggagaac
tgctcttgttttatgctaaagacattttaactcaggaggtcagcaatcatcacaggtaat
gaagcactgatccttacaacacaaattccttagattcaaatctataagacagccaagccc
EXON 3  120 bp
ttaggttggctgatacttttatattacacagaaagagtattgagtatctatggttgttcc
ccatgtataagggaagggaaaagatctaggaccattttagagccacctgatagccatctg
ttttaaaagttcagtaaatccgtgggcaagtgtaaccgttttctctaattctgattgcag
GTGCTTCAGTTTAATGAAGTGGGAGCCAATGCAGTTACCCCCATGACTCCAGAGAACTTT
ACCAGCTGTGGGTTCATGCAGCAGATCCAGAAGGGTAGTTATCCTGATGCGATTTTGCAG

gtatctgacttactggtccaaatttcttttgtggtttatttttgcaatcttcctgtctta
aagccacagtgtcagactgggaaggaagcgaatataccctcccccattcacagaaagaaa
actaagactcagagtcattaagaaaaacatgtcctaagatgatacccataacgagagacg
EXON 4  129 bp
tttaatgtaccacatccttatcgaaatgattttctcaaagattcctctaatgtaccaaaa
ataaagtatgtattaatatagcatttcatgattgtattcaaaaactattaccatggctta
agaactatcttgtttagtagttctgtgttatatataaagaattccttctttcttttcaag
GCACAAGCTGCAGATAAAATCCATTCATCCTTCCGCTCTCTCAGCTCTGCAATCAATGCA
TCCACAGGGAATTATTTACTGGAAAGTGTCAATAAGCTGTTTGGTGAGAAGTCTGCGAGC
TTCCGGGAA
gtaagtgaaacctgtaattgaaatggctggatcccaaacaagtaatgaagtcactttcaa
agcagttctctacaattcaacagttcataaaagcagagttggaattccacaccagctccc
tagggctggccttgcgtaacagctgcccttcctgtaccctctggggcttcctcctcttcc
EXON 5  118 bp
taagcgtggacaaaggggtctgcactctttcccccttcagcacctgccttccatagccaa
cctccactcccaccctaccccaggtctcctaatttcaatgggaagaccataattcaccat
tatgccatggcttgtttggtatgtattttatgtagcctttgtcattttcttgctttaaag
GAATATATTCGACTCTGTCAGAAATATTACTCCTCAGAACCCCAGGCAGTAGACTTCCTA
GAATGTGCAGAAGAAGCTAGAAAAAAGATTAATTCCTGGGTCAAGACTCAAACCAAAG
gtaaatccaagaaaatattttatttacttctttccagttagaaaactctgatctatcttt
ttccatccatgaacttagttagccctcacccctttacaatttgtccaactgcagttactt
tggtggatgtgaatttattcctgattagctcagtggtgttttaactgagaagaaataatt
EXON 6  143 bp
aagcttttgggaaatttgtttcaattttaattttgctttaaataaacctaaaaaacttta
gcttgaagattaacaactctgcaatttgaagaatttagtttgatggctactcagaagatt
cagtaagtaatttcacagttcttgattatgaaacctaaatatatgttatgttttctgtag
GCAAAATCCCAAACTTGTTACCTGAAGGTTCTGTAGATGGGGATACCAGGATGGTCCTGG
TGAATGCTGTCTACTTCAAAGGAAAGTGGAAAACTCCATTTGAGAAGAAACTAAATGGGC
TTTATCCTTTCCGTGTAAACTCG
gtatgagacaacaaaatacatcttcctagcatatattttagggcttttgacaagatatag
acagaaaaattagagaccgctcattatagacttgctagttagaagttatgcatgttggac
agttgattgactctttagaaacagtataggtaaaggggaagactgtggctttttaattat
EXON 7  165 bp
ttgaacaagctaataacatcagagtacccactgtaaggatgtacaaataatttattttgt
tgatttaaaaaaatcacatttatcctacactaaagtagaaccaatcctcctttatgtcta
attgtaaatctcttgatatcttataatcgacttccatattttaccttttaataatattag
GCTCAGCGCACACCTGTACAGATGATGTACTTGCGTGAAAAGCTAAACATTGGATACATA
GAAGACCTAAAGGCTCAGATTCTAGAACTCCCATATGCTGGAGATGTTAGCATGTTCTTG
TTGCTTCCAGATGAAATTGCCGATGTGTCCACTGGCTTGGAGCTG
gtaagacattcagatatttaagtttctggggctatacctacctttcgtgagatgagatga
atatatactccttacaaatggtgtggtaatttctcatggaaatatatgaaacagttgata
gtaaatatggcatgcctctacatttcattcaaagccttaactatgtcatacgtgttacct
EXON 8  986 bp
agccttaactatgtcatacgtgttaccttcttgtaaaaatctgaccaatctgttaacttt
ctatatcacccacaatatagtaaagtcactgatttttaatattagacttaaagttgtttt
ccttctttctaatacttgctgtattttcttttgtttgttttgttttgttttgctttgcag
CTGGAAAGTGAAATAACCTATGACAAACTCAACAAGTGGACCAGCAAAGACAAAATGGCT
GAAGATGAAGTTGAGGTATACATACCCCAGTTCAAATTAGAAGAGCATTATGAACTCAGA
TCCATTCTGAGAAGCATGGGCATGGAGGACGCCTTCAACAAGGGACGGGCCAATTTCTCA
GGGATGTCGGAGAGGAATGACCTGTTTCTTTCTGAAGTGTTCCACCAAGCCATGGTGGAT
GTGAATGAGGAGGGCACTGAAGCAGCCGCTGGCACAGGAGGTGTTATGACAGGGAGAACT
GGACATGGAGGCCCACAGTTTGTGGCAGATCATCCTTTTCTTTTTCTTATTATGCATAAG
ATAACCAACTGCATTTTATTTTTCGGCAGATTTTCCTCACCCTAAAACTAAGCGTGCTGC
TTCTGCAAAAGATTTTTGTAGATGAGCTGTGTGCCTCAGAATTGCTATTTCAAATTGCCA
AAAATTTAGAGATGTTTTCTACATATTTCTGCTCTTCTGAACAACTTCTGCTACCCACTA
AATAAAAACACAGAAATAATTAGACAATTGTCTATTATAACATGACAACCCTATTAATCA
TTTGGTCTTCTAAAATGGGATCATGCCCATTTAGATTTTCCTTACTATCAGTTTATTTTT
ATAACATTAACTTTTACTTTGTTATTTATTATTTTATATAATGGTGAGTTTTTAAATTAT
TGCTCACTGCCTATTTAATGTAGCTAATAAAGTTATAGAAGCAGATGATCTGTTAATTTC
CTATCTAATAAATGCCTTTAATTGTTCTCATAATGAAGAATAAGTAGGTATCCCTCCATG
CCCTTCTGTAATAAATATCTGGAAAAAACATTAAACAATAGGCAAATATATGTTATGTGC
ATTTCTAGAAATACATAACACATATATATGTCTGTATCTTATATTCAATTGCAAGTATAT
AATAAATAAACCTGCTTCCAAACAAC
aatacatttgttgtcatttcattaggtctgcagatcatagaccttgactcctaggagttg
agcattatgactcacttgtgagaactcagaaaaaatagacaggatgaaggagccaaggac
ataacaaccttcattcaaaaagacccaatgttgagggtcagtgggatggggttgtatgaa