Gene POLI Variant 1
DNA : 25.17 KbNT_010966
mRNA : 2470 bp NM_007195
CDS : 2148 bp NP_009126
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  107 bp
ccgcacgtgggcctccacgattccttggcatgcgtgtcactctgggcaacaggctggtcg
gccacgactgcgcaggcgagaggcacagagcgactggagactgtagtcccccggtttccc
tggagaccaggcggaagcggccggaagtagcgctgcggttggcagcggcgggatggagaa
GCTGGGGGTGGAGCCGGAGGAGGAAGGCGGCGGCGACGACGACGAGGAAGACGCCGAGGC
CTGGGCCATGGAACTGGCGGACGTGGGGGCGGCAGCCAGCTCGCAGG
gtgcgccgcagccagaggagccagcggcctccttgggtgtaaatgagaagggtggggcag
gcggacgctcggggcggcggccactggggcgcgaccgtccccgccccactcggctcctct
aagagagggctgcctccctctgccttgtgttacgcggcgggtacctctagaggaatggct
EXON 2  126 bp
gaccctaccctaagtggagtttcatgtctttgtaatttttcgatgctttcacacataatc
caggagaaaacacgtcactctgcattcttccttcacaggtaccatgttttaaggaactgt
cagttgctcagagataataagcagcctgaatttctttttatttctttgcatattgtgcag
GAGTTCATGATCAAGTGTTGCCCACACCAAATGCTTCATCCAGAGTCATAGTACATGTGG
ATCTGGATTGCTTTTATGCACAAGTAGAAATGATCTCAAATCCAGAGCTAAAAGACAAAC
CTTTAG
gtaactgtagatttataatatttttaattgcataatgattagattagcaactcatcatgc
tcattatatactgatttattaaccttattaagaaagattttggaagcagttcttacagtg
ctttatagctggtcatttttgcttcactaccaagtgtaaattttacaagcctcatttaat
EXON 3  165 bp
aatgtttctgcattatagagatttgatatatggaggctatgttttttaattgagacaggg
cttttgattcttatcaaaactgattgtcttacaatttagacaaatgtaatacggaattaa
taatatctttaaatgttttcttcaattgtgcttgggtttctcataaaatattttttacag
GGGTTCAACAGAAATATTTGGTGGTTACCTGCAACTATGAAGCTAGGAAACTTGGAGTTA
AGAAACTTATGAATGTCAGAGATGCAAAAGAAAAGTGTCCACAGTTGGTATTAGTTAATG
GAGAAGACCTGACCCGCTACAGAGAAATGTCTTATAAGGTTACAG
gtacaaatgataagcaatgtacttttagcattaatttttatgtaggatgcctgttcatta
catgaattttttaataaatgtaaaataacataagtcaagatgctttttcctaataacttc
ttattttgggtcttgtcaactttaaaaattatgtgaaaggataactgtatgctatgaata
EXON 4  153 bp
acaagatgtggtacagaaaaaacgtcaattaactgagggctttattaaagatattatgga
actatgaatgtatataaaacctttaacaataaatttgataaatttttaagcactagatag
ttaaatttatcctagttataacttcatttacatttgtgctccaatattatttcaatttag
AATTACTGGAAGAATTTAGTCCAGTTGTTGAGAGACTTGGATTTGATGAAAATTTTGTGG
ATCTAACAGAAATGGTTGAGAAGAGACTACAGCAGCTGCAAAGTGATGAACTTTCTGCGG
TGACTGTGTCGGGTCATGTATACAATAATCAGT
gtgagtgggttcttattcattctacctactaaccaaaagtacatacatttcttaatgttc
agtgagttcgctgtgtgattctgaaagattcatgacttttgttggaggtatagttatatt
tagtcagtaatctgtctaggacagctaaaattaggtgctgctattccataataagtgtta
EXON 5  237 bp
caaattacaacatgaggtttggaggggacaaatatcacaaccataccaggtgatgatggt
ggtggttgtggtggtggtggttgttggatatagactaagccctctaccttttaaaaatta
ttttgtgaaaaagaaaaaggtttttcttgtgactttgaatgacatttgttgtttttaaag
CTATAAACCTGCTTGACGTCTTGCACATCAGACTACTTGTTGGATCTCAGATTGCAGCAG
AGATGCGGGAAGCCATGTATAATCAGTTGGGGCTCACTGGCTGTGCTGGAGTGGCTTCTA
ATAAACTGTTGGCAAAATTAGTTTCTGGTGTCTTTAAACCAAATCAACAAACAGTCTTAT
TACCTGAAAGTTGTCAACATCTTATTCATAGTTTGAATCACATAAAGGAAATACCTG
gtaagacaaatatatttgaaaagtacatatacgtcttattttatttcttttaatttaaaa
aattatagatacaatgtaattaattcttaggtagagttgtctgtgagtttgtgtgcatgt
gtgtgtgtgtgtatacttggttcctggaaaaaactaagaaaaactgtaatgttttctcaa
EXON 6  179 bp
tactgtccatggtttcaggcatccactgaaggtcttagaatgtatcccctgtggataagg
ggggactactgtataaattatagaacttaaagataagattgatatatttataatatttta
attagctttgttttaaggagaaaagctattttaacattgtatgcatttctttttatttag
GTATTGGCTATAAAACTGCCAAATGTCTTGAAGCACTGGGTATCAATAGTGTGCGTGATC
TCCAAACCTTTTCACCCAAAATTTTAGAAAAAGAATTAGGAATTTCAGTTGCTCAGCGTA
TCCAAAAGCTCAGTTTTGGAGAGGATAACTCCCCTGTGATACTCTCAGGACCACCTCAG
gtacatgatgatacttattttaattaagtactggttatcacattatttgagataaagatt
tctagttttagtaccatgttcttactattctagtttgcttagtatgtgatccctttccta
ttagaaggctgatttattattaatagattggattaataagtattcttaaatggaatctta
EXON 7  92 bp
gtgagtacaatagcttgcagataaaaaactgttaatataaaagtgaactaaatggctcaa
actaaggacaagaggtaagttagtgaagaatgtattgaatatttatttgactgtacactg
ataataattagatatagttatttgagtttgtgctaatccttatttatgcttctttgatag
TCCTTTAGTGAAGAAGATTCATTTAAAAAATGTTCATCTGAAGTTGAAGCTAAAAATAAG
ATTGAAGAACTACTTGCTAGTCTTTTAAACAG
gtgattttcaatccattttgccaagtcatcctatgtattcattctatatacggtatgtgg
aaagaatatttgatgttccatcttggaactgacagattatctggagactaaacaatgtaa
aaataatttatcatgggatttctctgctttataaactgttgtaaagatggtaataggggg
EXON 8  131 bp
agactttgtgatgattatttggatactcagggacctttattgcttactattttgttatct
gctatatgtataattgtcatatttaacaaaatctggcacctttagataaatgagatgtta
cataatttaaaaaggtaatacttttctaattccttatttccactttctctttatttttag
AGTATGCCAAGATGGAAGGAAGCCTCATACAGTGAGATTAATAATCCGTCGGTATTCCTC
TGAGAAGCACTATGGTCGTGAGAGTCGTCAGTGCCCTATTCCTTCACATGTAATTCAGAA
ATTAGGGACAG
gtatggactagttttccaacagtttcattagcaggttgaactcttaaataagccaacttt
gaatgagaaatatgctccaaaaatggagggtcttcacagggaattagcaagcaattaaat
gcttttattctatcaggaattttcactggaaaactttgttgtttgtttatttatttattt
EXON 9  206 bp
tatttcaaatcttttgaaaatttttaaccatttagtattaatattgaaatgtcttaattt
ggtatataatgtcaagatgcccagtgatatttaggattttaatttcttaatctcagcaat
ataaaatatattatgctcttaatattaattataatgtttattcttaaacattttatttag
GAAATTATGATGTGATGACCCCAATGGTTGATATACTTATGAAACTTTTTCGAAATATGG
TGAATGTGAAGATGCCATTTCACCTTACCCTTCTAAGTGTGTGCTTCTGCAACCTTAAAG
CACTAAATACTGCTAAGAAAGGGCTTATTGATTATTATTTAATGCCATCATTATCAACTA
CTTCACGCTCTGGCAAGCACAGTTTT
gtaagtacactcttttttgttcagttttctaagtatactcttatgggatttgtgtggtta
cattacaaatctaagtgcttgtctttttgatatagtttagagattcttttgggtgatatt
gtttaggtgattaacttgtttataatacctatcttatggtttctggccttaaatatgctg
EXON 10  1074 bp
cacaaaatagtgtgaataattgtggtagtagatctctagttgtttggaactggccacaaa
gagttgtatttgttgagtaggttagaaacatgtcagataatagctacaggcacacagcag
cagcagcgatatttaaaagatatcagatatgtaaattagtctgttattcttgtgttctag
AAAATGAAAGACACTCATATGGAAGATTTTCCCAAAGACAAAGAAACAAACCGGGATTTC
CTACCAAGTGGAAGAATTGAAAGTACAAGAACTAGGGAGTCTCCACTAGATACCACAAAT
TTTTCTAAAGAAAAAGACATTAATGAATTCCCACTCTGTTCACTTCCTGAAGGTGTTGAC
CAAGAAGTCTTCAAGCAGCTTCCAGTAGATATTCAAGAAGAAATCCTTTCTGGAAAATCT
AGGGAAAAATTTCAAGGGAAAGGAAGTGTGAGTTGTCCATTACATGCCTCTAGAGGAGTA
TTATCTTTCTTTTCTAAAAAACAAATGCAAGATATTCCCATAAATCCTAGAGATCATTTA
TCCAGTAGCAAACAGGTATCCTCTGTATCTCCTTGTGAACCGGGAACATCAGGCTTTAAT
AGCAGTAGTTCTTCTTACATGTCTAGCCAAAAGGATTATTCATATTATTTAGATAATAGA
TTAAAAGATGAACGAATAAGTCAAGGACCTAAAGAACCTCAAGGATTCCACTTTACAAAT
TCAAACCCTGCTGTGTCTGCTTTTCATTCATTTCCAAACTTGCAGAGTGAGCAACTTTTC
TCCAGAAACCACACTACAGATAGCCATAAGCAAACAGTAGCAACAGACTCTCATGAAGGA
CTTACAGAAAATAGAGAGCCAGATTCTGTTGATGAGAAAATTACTTTCCCTTCTGACATT
GATCCTCAAGTTTTCTATGAACTACCAGAAGCAGTACAAAAGGAACTGCTGGCAGAGTGG
AAGAGAGCAGGATCAGATTTCCACATTGGACATAAATAAGCATATTCAGCAAAAAGGTCT
GAAAAGCAAGGGAATACCATTATTTTCGGATTAGCGGTTTATTAAGCTCTTCTATATTAA
ACACTAATAGATATTCAATAACGGAGTAAACTGTTCCAGATAAAGCAAGAATAGTTGCAA
GAAGTAAATTCTGGCACAAAGCGTAAAAATATAACAGAAGAAATAATGTAAAATACTATC
TTTTATGTCTAAAGCCATTTTATATTACTTTTCAATAAAAAGAATATCATGGTC
aacatagaatatttttcatgaattggtggggagatgtatatgtttatatataaaaaatag
ccaaatcgttgcaatgatatggtaaaggacacattttttttttttttttcctgtgaaatg
tggaatatctcaaattcagcctcttaggctgaatagcaaatcctactgccaactaaccta