Gene MBD1 Variant 2
DNA : 12.63 KbNT_010966
mRNA : 2655 bp NM_002384
CDS : 1512 bp NP_002375
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  114 bp
cgcgcaccgctgcggagcgccggcccgtaggcgcgggagcctccctattaagggcacgcg
acatcgaggcaatagtgcgcaggtgcttagccagaggcggagcccgagaggcaggcagcg
gacttccggttccgggagcaacgaacagccgcggaggcgacagctaccgcttcagaggag
GCGGCCGCGGAGGAGGAGGAAGGGGAGGAGGGCGAGGCGGGAGGTGCAGGAGGGACCCTC
GCCATGGGTCCACGGGCCTAGAGTGGCGGAAGATACCGGCCTGGTGCCAAACTG
gtgagacagccttggggctggacgtggagagcgctcaggcggaggatgggaaggaattgt
ggctcagaacgctgacggggaggaatgaagggccctcaggccgataagggggaggaatgg
cggcgtcggaatactgacgaggagaaatggggggatttaggctgaggacgggaaggaatg
EXON 2  135 bp
aataggaaagaatggggtgagaatatgaggggtttcttttccatatatgggctggttgcc
tgtggcaggtcctagggcttgggcaagcactaatggataccagtgatttgtgtggcctgg
ggcacagtgttgtcccttcctagagcctcagtttccctcatcccttccaccccctttcag
GCTACTGCTGCTTCCTGTGGCCTCCATGGCTGAGGACTGGCTGGACTGCCCGGCCCTGGG
CCCTGGCTGGAAGCGCCGCGAAGTCTTTCGCAAGTCAGGGGCCACCTGTGGACGCTCAGA
CACCTATTACCAGAG
gtactgggtgggtagtgggcagagtcaggagtggggtagagcctgattctggtaaaatca
aatggtgtggttaaatttatggatgaagtttaaattatgcacatacagttaatccttatt
agcggattttatgtttgaatttcacctacttaataaaatttatttgtaacttaaaagtca
EXON 3  115 bp
atgtgttggtatttatattaatttttttatgttttcaaggttagttgaggtgggggctgg
gcagggctcacaagccaattccaggctgcctcctatatcctgccagccctgtcaaaaggt
tgtatgagtgaaatggcattggctccacctgggtgctaacccatcatggcccatccctag
CCCCACAGGAGACAGGATCCGAAGCAAAGTTGAGCTGACTCGATACCTGGGCCCTGCGTG
TGATCTCACCCTCTTCGACTTCAAACAAGGCATCTTGTGCTATCCAGCCCCCAAG
gtacttcacaacatgagatacctaggtaggggtggatgtgccacccaacacccaaccact
gacccatattcctccttcccttactttccaggcccatcccgtggcggttgccagcaagaa
gcgaaagaagccttcaaggccagccaagactcggaaacgtcaggttggaccccagagtgg
EXON 4  167 bp
aagttgagctgactcgatacctgggccctgcgtgtgatctcaccctcttcgacttcaaac
aaggcatcttgtgctatccagcccccaaggtacttcacaacatgagatacctaggtaggg
gtggatgtgccacccaacacccaaccactgacccatattcctccttcccttactttccag
GCCCATCCCGTGGCGGTTGCCAGCAAGAAGCGAAAGAAGCCTTCAAGGCCAGCCAAGACT
CGGAAACGTCAGGTTGGACCCCAGAGTGGTGAGGTCAGGAAGGAGGCCCCGAGGGATGAG
ACCAAGGCTGACACTGACACAGCCCCAGCTTCATTCCCTGCTCCTGG
gtgagtgttggtctaaggtgagccagatgggtgagggttgtgattgggggtgctcttgga
gccccacacctgcctttcccatcccaggtgctgtgagaactgtggaatcagcttctcagg
ggatggcacccaaaggcagcggctcaaaacgttgtgcaaagactgtcgaggtgagtggcc
EXON 5  83 bp
tggaccccagagtggtgaggtcaggaaggaggccccgagggatgagaccaaggctgacac
tgacacagccccagcttcattccctgctcctgggtgagtgttggtctaaggtgagccaga
tgggtgagggttgtgattgggggtgctcttggagccccacacctgcctttcccatcccag
GTGCTGTGAGAACTGTGGAATCAGCTTCTCAGGGGATGGCACCCAAAGGCAGCGGCTCAA
AACGTTGTGCAAAGACTGTCGAG
gtgagtggcctccagaggatggggcatcgggagataggagctggagcaggtccagtgtca
tgctaggctggggtttgaatgtggatgtcaggacagaggctactggcatggttggaggtt
ggatattggagatagcaggcataggtagaggttgaatagtggaagtcagggcacaggcag
EXON 6  41 bp
taggctggggtttgaatgtggatgtcaggacagaggctactggcatggttggaggttgga
tattggagatagcaggcataggtagaggttgaatagtggaagtcagggcacaggcagtga
gtgaagtcagatgtctgttgcttcctttccacttttcttcttccctcttcctccccacag
CACAGAGAATTGCCTTCAACCGGGAACAGAGAATGTTTAAG
gtaagcacaacctgcttcctcttcacaactctgcagtgggagcaggatgtgatggagctg
gtagagtctgaagggatgatgatgggtccacaggatgaagagtcattttatagggtgctc
tccataggtcagcagacacaataatgggaattaatggggtaattaatccccattaccatt
EXON 7  147 bp
gaccagtagacatactaatggcctcagtgatggtgactaaccagaccttctcagatacgg
tgatgaggctaatgggggactaaaattcatggtgatgccagctgatgtagggtcagtaga
catgggaggaccagtgcttctggagcaggcccgtgatctcgtccctaccattcctggcag
CGTGTGGGCTGTGGGGAGTGTGCAGCCTGCCAGGTAACAGAAGACTGTGGGGCCTGCTCC
ACCTGCCTCCTGCAGCTGCCCCATGATGTGGCATCGGGGCTGTTCTGCAAGTGTGAACGG
AGACGCTGCCTCCGGATTGTGGAAAGG
gtgagttgggcaagtggaaagagcccaaggctcacctcggcccctggcccccatgggctt
ggccccatgcttcatgcctctgctcccacctgccccccgccaacagagccgagggtgtgg
agtatgccggggctgtcagacccaagaggattgtggccattgccccatctgccttcgccc
EXON 8  129 bp
agctgccccatgatgtggcatcggggctgttctgcaagtgtgaacggagacgctgcctcc
ggattgtggaaagggtgagttgggcaagtggaaagagcccaaggctcacctcggcccctg
gcccccatgggcttggccccatgcttcatgcctctgctcccacctgccccccgccaacag
AGCCGAGGGTGTGGAGTATGCCGGGGCTGTCAGACCCAAGAGGATTGTGGCCATTGCCCC
ATCTGCCTTCGCCCTCCCCGCCCTGGTCTCAGGCGCCAGTGGAAATGTGTCCAGCGACGT
TGCCTACGG
gtgagttgggctggagggagcagagctcattctgctgttaaaatcgtcgctgcctctgct
tcctttcaacctggccttgcctacctcatgtctttcttttctgcctaaccctatgctcgc
ctttctggccccgcctacctgcctctgtctgccagcaccttgctcaccgcctgcgtcgcc
EXON 9  117 bp
gtcgccgtcatcagagatgtcagcgacgcactcccctggctgtggctcccccaactgtga
gtgcctcacgccaccctctgtctgcctgtcccatgcatgctttctgcacttagggtgtgg
ggagtttctgtgtctgcctggtgccaccaagctgaaaccaccctttctgatctttcccag
GGTAAACATGCCCGCCGCAAGGGAGGCTGTGACTCCAAGATGGCTGCCAGGCGGCGCCCC
GGAGCCCAGCCACTGCCTCCACCACCCCCATCACAGTCCCCAGAGCCCACAGAGCCG
gtgaggccccagtgggtggagggaaggcacaaccctgaccttacccagtacctgccctga
ccccaccccatttgcctctacagcaccccagagccctggccccctcgccacctgccgagt
tcatctattactgtgtagacgaggacgagctagtgagtggccccaccctacctggataag
EXON 10  69 bp
gggaggctgtgactccaagatggctgccaggcggcgccccggagcccagccactgcctcc
accacccccatcacagtccccagagcccacagagccggtgaggccccagtgggtggaggg
aaggcacaaccctgaccttacccagtacctgccctgaccccaccccatttgcctctacag
CACCCCAGAGCCCTGGCCCCCTCGCCACCTGCCGAGTTCATCTATTACTGTGTAGACGAG
GACGAGCTA
gtgagtggccccaccctacctggataagcctagaatctcaggacgcttggttaacttcaa
agaagcagatgctggaatgagcctattggggaacagcaaggcacaataatgggtcctagg
atgggatgagtagataatggaggactaatacggggtcagcaggtgcatgagagtgcttca
EXON 11  300 bp
tgagtctaggtggcattggtgttgctaataggagactagcaggctcagtgatgaagggct
catatgtaagcagattccgtgctgggactgatgggagattagcaggcatgtggagccggg
cagggtggatgtgattggtcaggacaccaggtagccatagcaccctatctttccccatag
AAGCGGCTGCTGCCCAGTGTCTGGTCAGAGTCTGAGGATGGGGCAGGATCGCCCCCACCT
TACCGTCGTCGAAAGAGGCCCAGCTCTGCCCGACGGCACCATCTTGGCCCTACCTTGAAG
CCCACCTTGGCTACACGCACAGCCCAACCAGACCATACCCAGGCTCCAACGAAGCAGGAA
GCAGGTGGTGGCTTTGTGCTGCCCCCGCCTGGCACTGACCTTGTGTTTTTACGGGAAGGC
GCAAGCAGTCCTGTGCAGGTGCCGGGCCCTGTTGCAGCTTCCACAGAAGCCCTGTTGCAG

gtgagggccccaccctgtcctgccttcccagcctcacccagctgcatgccagggagctga
gaccaagtctgctgcaatcctccctcacgcaggaggcccagtgctctggcctgagttggg
ttgtggccttaccccaggtgaagcaagagaaggcggatacccaggacgagtggacaccag
EXON 12  132 bp
agaaaaacggaggtcagtgaggaatgggaatgggaaagctttgtaggcagagagatggac
tttctgtgttgaaatgtgatggaagtaggatttgtcagcacagtgaggggttggctgata
gagactttcctcaggtgaactctgcccttctaatggttgcctgtttcctacttctcccag
GCAGTAGACCCAGGCCTGCCTTCTGTGAAGCAAGAGCCACCTGACCCAGAGGAGGACAAG
GAGGAGAACAAGGATGATTCTGCCTCCAAATTGGCCCCAGAGGAAGAGGCAGGAGGGGCT
GGCACACCCGTG
gtcagtgctggggatgccccaccctgccctgaccctgctgtagccccaacaaccacattg
acctatggtgttaattcttctctagatcacggagattttcagcctgggtggaacccgctt
ccgagatacagcagtctggttgccaaggtgtgccccacacagtgaggggtggggaaggag
EXON 13  62 bp
cacctgacccagaggaggacaaggaggagaacaaggatgattctgcctccaaattggccc
cagaggaagaggcaggaggggctggcacacccgtggtcagtgctggggatgccccaccct
gccctgaccctgctgtagccccaacaaccacattgacctatggtgttaattcttctctag
ATCACGGAGATTTTCAGCCTGGGTGGAACCCGCTTCCGAGATACAGCAGTCTGGTTGCCA
AG
gtgtgccccacacagtgaggggtggggaaggagtgggtgttggccagatgtgggccctga
gttttgaaagtatagccggcagtttggcatggtgtggtgggaggtaaaggcccataccca
ctatgctggtcacaattaatgaggggcgtgtgtgtaggaccctagagatttctcctgaga
EXON 14  72 bp
tataatctgactatgtacaagctgtctataatggtagtttttagaagatataaaaaaaga
taaaggataattaaggggaagtggatggaggacacagaatagtaggaaatggttttgtaa
tgctccattgcgcacatagcaaacctcattcaacatacagacctgctcccttttccctag
GTCCAAAGACCTTAAAAAACCTGGAGCTAGAAAGCAGTAGACTGGAGGCTTCTACAGACT
GTAGGATTCAAG
gtgatatttgcagactggctttatgagagacaacactgatctactaggggctggacccta
gattggttgccagggcttgtgtgtgaatcaaccctaggaggaaaaacctactaccaaacc
agaagagcaggcctaagagtactttgagcttctagaagaagtaagcgggaaaggaagaga
EXON 15  972 bp
agcttctgctgaccatttatgttagggtacaatcagaggagcagaaccactaagataaag
attatgtatatatgtattttaagggatttattatagggatctgaccgcatgccattgtgg
gagctggttaaacagtctctgtaaggctgttgtctttgcatctaatgctggagcttgaag
TCTGCAGGGCAGGCACTCGGGAAGGGAAGATGGATGTAAAGTGTGGGAGACCGAGGACAC
AGTGGAGCCCACGAGCACGAGCTGGAACCCACGAGGATGGCCTGGAACCCATGTCAGTCT
CTCACCACCTCCAGCTTCGATGATGTGGGTGTCCTGCAGAAGAAGCTGGTGCCCTTCCTC
ACAGAGTTAAATATGCATCTGGCCCAGGAATTAGAGAAGCTGAAAGGATGATCCTGGGGA
AGGTGGAGCAGCTGCAGGCCTGGCTGCAGGCCTGACTACTGCCCACACCAACGAGGTGAT
CTAGCAGATACATGGCAACGTGTGAACTGCAACAACGCCTGGTGCCCCAGCACCAACCTT
CCAAGTGTAAAAACAATGTGCTGCTGCTTCACTTCCGCCCTCCGGTTATCAAGCAAAATG
TCTCTTGTGGCCCATCTTACTGGAAGAGAGTTCCGGGAAACATAGCCTCACCAAGGTGAC
ACATTACAAAGCCACCCTACCATGAATCCGCTCCCAAGGGTCTCACTGCTCACCTGAGGA
TAACTCAATATAACTATGTGGCTGAAAATGCAAAGCTGAAGACCATGGATTTCATGGTGA
TTCCAGCAAGTACAGAGATTCTATGAAGCCCACCCAGAAAAAACTTGCTGGTCCTGGCTA
TTTTTGTGTCATTTATTCAAGTATTGAGAACCTGGCCTGTGGTAGGCACTGTACTTAATA
CTAGGATACAGAAATGCAAAAGATACGGCCCATGCAATTTTATTAAATGCATCAATATGT
ATTACAAATGGTGAATGGATTTCCAACTTTATCATGGAATTTAATGCTGAATATATAGAA
TTCAGAAAATTGTTGGGAGGACAGCCCTTTTGTGAACCTTGTTTGGGGCACAGTAGGAAT
TGGAAATAATTTAGTTTCTATCTCTAAGCTGTTCTATTTTAAAATTATTTTTAAATTTTT
ATTGTCCCACTT
acttacatgcttagtgtttcttttgggagtggtttggtgggaacagtgttgactgcctct
gagaaactgggatagtgggtgggaagatcaaatcaaggtcacttctttccaaggaccctg
agcgattcacttacctaggccgcgggggcggggggttggctgaaggctgaggctcttggt